Main

We wished to define better the role, if any, of Wnt signalling in HSC specification during embryonic development. Although Wnt signalling can exert strong effects on adult HSCs, an in vivo regulatory function is controversial, and the role of Wnt signalling in establishing haematopoiesis during development is unclear2. Wnt signalling pathways have been loosely grouped into two families: canonical and non-canonical2,3. Canonical signalling is defined by stabilization of β-catenin, which in cooperation with lymphoid-enhancer-binding factor/T-cell factor (Lef/Tcf) DNA-binding proteins, activates transcription of Wnt target genes2,3. Non-canonical signalling is β-catenin/Tcf-independent, with less well-characterized intracellular pathways3. Disruption of canonical signalling in zebrafish by targeted deletion of wnt3a results in HSC deficits2, but these animals have massive morphological defects, including near absence of the caudal tissues4 where HSCs arise during embryogenesis. Canonical Wnt signalling by unknown ligands also seems to have a role in maintaining and/or expanding very early HSCs in cooperation with prostaglandins5. At present, no studies have demonstrated an absolute requirement for Wnt signalling in the earliest specification of recognizable HSCs, and no requirement for β-catenin/Tcf-independent, non-canonical signalling has been reported.

We searched for candidate Wnt proteins expressed near pre-haematopoietic mesoderm and identified a previously uncharacterized zebrafish wnt16 orthologue (Supplementary Fig. 1) expressed in the dorso-anterior portion of more rostral somites from 10 h post fertilization (h.p.f.; tailbud stage) to 24 h.p.f. (Supplementary Fig. 2), the time frame when pre-haematopoietic mesoderm transitions to recognizable HSC precursors in the dorsal aorta. Wnt16 is conserved across vertebrate phyla (Supplementary Fig. 1), and the human form was originally identified as a gene inappropriately expressed in pre-B-acute lymphoblastic leukaemia (ALL) cells containing the E2A-PBX1 t(1;19) translocation product6. In zebrafish, two wnt16 splice variants are produced, only one of which is active (Supplementary Figs 1a, b and 3 and Supplementary Table 1).

Knock down of Wnt16 by injection of either of two ‘splice-blocking’ morpholinos (W16MO) caused a striking haematopoietic phenotype. Morpholinos alone or in combination reduced levels of functional wnt16 mRNA (Supplementary Figs 1a and 4), yielding highly similar phenotypes in comparison to a 5-base-pair mismatch control morpholino, which had no effect (Supplementary Figs 4 and 5). Whole-mount in situ hybridization (WISH) revealed that HSC precursors, a population of runx1+ cells in the ventral floor of the dorsal aorta1,7,8, as in mouse9, are absent in embryos injected with W16MO at 24 h.p.f. (red arrowhead; Fig. 1a, b and Supplementary Table 2). By 33 h.p.f., HSCs can be observed as a population of cmyb+ cells between the dorsal aorta and posterior cardinal vein1, and this population is also absent in W16MO-injected embryos (red arrowhead, Fig. 1c, d and Supplementary Table 2). HSCs observable in living transgenic animals carrying GFP under the control of the cd41 (also known as itga2b) promoter10,11,12 are absent or reduced in wnt16 morphants (red arrowheads, Fig. 1e, f; see also Supplementary Movies 1 and 2 and Supplementary Table 2), as are unique double-positive cells in kdrl:RFP and cmyb:GFP double transgenics7 (Fig. 1g, h, yellow cells; see also Supplementary Table 2), whereas unrelated GFP-labelled multiciliate cells in the pronephros are unaffected (yellow arrowheads in Fig. 1e, f and green cells in Fig. 1g, h). Generation of T lymphocytes requires an HSC precursor10,11,13, providing a useful readout for whether HSCs have been specified or not. In cd41:GFP transgenic animals, GFP+ HSCs retain residual fluorescence as they differentiate into the first thymic lymphocytes around 3 days post fertilization (d.p.f.)10, and these thymic immigrants are greatly reduced in wnt16 morphants (Supplementary Movies 3 and 4). Accordingly, wnt16 morphants lack rag1+ T lymphocytes at 4.5 d.p.f. (blue arrows, Fig. 1i, j and Supplementary Table 2), despite intact thymic epithelium (Supplementary Fig. 6). Together, our results indicate that Wnt16 is required for the specification of HSCs during embryonic development.

Figure 1: Wnt16 is required for the specification of HSCs.
figure 1

a–d, Expression of the HSC markers runx1 (a, b) and cmyb (c, d). e–h, Fluorescently labelled HSCs in cd41:gfp (e, f) and cmyb:GFP;kdrl:RFP transgenics (g, h). i, j, Expression of the lymphocyte marker rag1. Embryos are either uninjected (left column) or injected with 5 ng W16MO (right column). Red arrowheads identify the aorta region (a, c) or individual HSCs (e). Green arrowheads identify unaffected runx1+ neurons (a, b). Yellow arrowheads identify unaffected GFP+ multiciliate cells of the pronephros (e, f). Yellow cells are HSCs (g). Blue arrows identify thymic T cells (i). a–h, Dorsal up, anterior left. i–j, Ventral views, anterior up. Original magnification at ×200.

PowerPoint slide

Full size image

To determine the specificity of W16MO-induced defects, we examined the integrity of non-haematopoietic tissues by morphology and expression of marker genes (Fig. 2 and Supplementary Table 3). Wnt16 morphants are grossly normal (Fig. 2a, b), with intact and functional vasculature, as evidenced by beating hearts and circulating primitive, non-HSC-derived erythroid cells, although there appear to be subtle patterning defects in the number and position of intersegmental vessels. WISH revealed that W16MO-injected embryos have primitive blood (gata1; Fig. 2c, d and Supplementary Table 3), somites (myod; Fig. 2e, f and Supplementary Table 3), vasculature (tll1, cdh5 and kdrl (also called flk1); Fig. 2g–l and Supplementary Table 3), dorsal aorta (efnb2a; Fig. 2m, n; notch1b, notch3, dll4; Supplementary Fig. 7a–d, o, p and Supplementary Tables 3 and 5), hypochord (col2a1a; Fig. 2o, p and Supplementary Table 3), notochord and floorplate (shha; Fig. 2q, r and Supplementary Table 3), and pronephros (cdh17; Fig. 2s, t and Supplementary Table 3). Thus, defects in HSC specification in wnt16 morphant animals are highly specific and not due to wholesale failure in the specification of nearby tissues.

Figure 2: The wnt16 loss-of-function phenotype is specific.
figure 2

a–t, Uninjected or W16MO-injected embryos in bright-field (a, b) or processed by WISH for tissue-specific genes: primitive blood (gata1, c, d), somites (myod, e, f), vasculature (tll1, g, h; cdh5, i, j; kdrl, k, l), dorsal aorta (efnb2a, m, n), hypochord (col2a1a, o, p), floorplate and notochord (shha, q, r), or pronephros (cdh17, s, t) at the developmental times indicated. Red arrows, dorsal aorta (m, n); green arrows, hypochord (o, p). Anterior left. a–r, Dorsal up. s, t, Dorsal views. a–f, q–t, Original magnification at ×64; g–p, original magnification at ×200.

PowerPoint slide

Full size image

Canonical, β-catenin/Tcf-dependent Wnt signalling has been reported to be involved in HSC specification in mice2 and very early maintenance in zebrafish5. We therefore wanted to determine if Wnt16 is canonical. Overexpression of Wnt16 caused phenotypic defects, demonstrating active protein (Supplementary Fig. 3), but in comparison to Wnt3 (ref. 14) it did not cause ectopic expression of canonical targets (Supplementary Fig. 8). Conversely, Wnt16 knock down caused no decrease in canonical reporter activity (Supplementary Fig. 9). Thus, Wnt16 does not act via β-catenin/Tcf and must act via a non-canonical pathway, as has been suggested for human WNT16B (refs 15, 16). Loss of other non-canonical Wnt ligands causes distinct phenotypes. Loss of Wnt5b is much more severe, causing nearly complete absence of primary trunk vasculature17, whereas loss of Wnt11 had no effect on HSC specification (Supplementary Fig. 10 and Supplementary Table 4). We therefore conclude that the HSC defects caused by loss of wnt16 are not a general consequence of loss of non-canonical Wnt signalling.

Notch signalling is required across phyla for the developmental specification of HSCs1. Global inhibition of Notch signalling by mutation or targeted deletion of mind bomb (mib)—which is required for Notch ligand activity—or the essential Notch DNA-binding co-factor Rbpjκ results in total loss of HSCs, as well as severe vascular defects1. If Wnt16 were to regulate Notch pathway genes, this regulation might explain the loss of HSCs in wnt16 morphant animals. The specific ligands and receptors required in zebrafish for specification of HSCs by the Notch pathway have not been determined. We therefore examined comparative expression of Notch ligands and receptors that might participate in HSC specification in uninjected or W16MO-injected animals. Most Notch receptors and ligands were either unaffected or very weakly affected (Supplementary Fig. 7 and Supplementary Table 5). However, expression of two Notch ligands, dlc and dld, was markedly decreased in somites at 17 h.p.f. (16-somite stage (ss); Fig. 3a–d and Supplementary Table 5). In accord with decreased somitic ligand expression, Notch reporter activity was decreased in somites at 17.5 h.p.f. (Supplementary Fig. 11). Interestingly, diminution of dlc and dld was tissue specific, because expression was maintained in pre-somitic mesoderm (Fig. 4a–d), and dlc expression in the dorsal aorta appeared relatively normal at 22 h.p.f. (Supplementary Fig. 12 and Supplementary Table 5). Although Wnt16 function is required for somitic expression of dlc and dld, we see no evidence for reciprocal regulation of wnt16 by Dlc and Dld (Supplementary Fig. 13), or indeed by Notch at all, as expression is unaffected in mib mutants (not shown).

Figure 3: Wnt16 acts upstream of Notch ligands Dlc and Dld.
figure 3

a–d, Expression of somitic dlc (a, b) and dld (c, d) but not myod (red) is decreased at 17 h.p.f. in W16MO-injected embryos. Red bars indicate somites. e–l, Expression of the HSC markers runx1 at 24 h.p.f. (e–h) and cmyb at 36 h.p.f. (i–l) is reduced in dlc mutant (bea) embryos (f, j) or dldMO-injected embryos (g, k), and eliminated in the combined animals (h, l). m–p, The lymphocyte marker rag1 at 4.5 d.p.f. is present in wild-type (m, WT), bea (n) and dldMO-injected animals (o), but eliminated in bea embryos injected with dldMO (p). q–x, Combined injection of dlc and dld rescues HSCs in wnt16 morphants. Runx1 at 24 h.p.f. One group of embryos was uninjected, or injected with the indicated Notch ligand mRNAs alone (q–t). A second group of W16MO-injected embryos was co-injected with Notch ligand mRNAs (u–x). y, Percentages of embryos displaying the depicted phenotypes. a–d, ×100 (original magnification) views of flat mounts, anterior left. e–l, q–x, ×200 (original magnification) lateral views, anterior left, dorsal up. m–p, ×200 (original magnification) ventral head views, anterior up. Red arrowheads indicate the aorta region.

PowerPoint slide

Full size image
Figure 4: Non-cell-autonomous requirement for Notch in HSC specification.
figure 4

a–d, Expression of the Notch target gata2 (a, b) and the Notch ligand jag1b (c, d) in uninjected (a, c) or W16MO-injected (b, d) embryos at 22 h.p.f. e–h, Whole-mount immunofluorescence visualization of the Myc-tagged NICD at 1 h (e, f) and 3 h (g, h) after either no induction (e, g) or heat-shock (HS) induction (f, h). i–l, Cmyb expression at 36 h.p.f. in transgenic animals carrying a heat-shock-inducible dominant activator of Notch signalling (NICD) in uninjected (i), W16MO-injected (j), W16MO-injected and heat-shock induced at 14 h.p.f. (10-ss; k) or 16 h.p.f. (14-ss; l). Red arrowheads indicate the dorsal aorta region. Red circle indicates the area where HSCs should normally be expressed (l). m–p, Green-to-red photoconvertible Kaede Notch reporter animals were entirely photoconverted at the times indicated at the left of each panel pair and imaged at 3 d.p.f. Confocal images of the dorsal aorta (white arrowheads; left panels of m–p) and thymus (dashed white outline; right panels of m–p) reveal photoconverted cells only in the thymi of fish converted at 24 and 27 h.p.f. (right panels of o, p). q–t, Max-projection confocal images of the trunk region of embryos processed by double fluorescence in situ for a Notch reporter GFP transgene (green) and the haematopoietic mesoderm marker etsrp (red) at the times indicated. Yellow arrowheads indicate double-positive cells (r–t). a–d, i–l, ×200 (original magnification) lateral views of the trunk region, anterior left, dorsal up. e–h, ×100 (original magnification) whole-embryo views. m–p, Cropped, ×200 (original magnification) lateral views of the dorsal aorta (left panels). m–p, Single thymic lobes (right panels). q–s, Cropped, ×200 (original magnification) dorsal views, anterior left. t, Cropped, ×100 (original magnification) lateral aorta view, anterior left, dorsal up.

PowerPoint slide

Full size image

To determine whether alterations in the expression of dlc and/or dld might explain the decrease in HSCs we observe in wnt16 morphant animals, we tested whether loss of function in these genes alone or in combination could alter HSC specification. Beamter (bea) mutants carry a predicted null allele of dlc18. We compared HSC and T-lymphocyte marker expression in wild-type embryos, homozygous bea mutants, embryos injected with dld morpholino (dldMO)19, and homozygous bea mutants injected with dldMO. We found that runx1 transcripts at 24 h.p.f., and cmyb at 36 h.p.f., were greatly reduced in bea homozygous mutants and embryos injected with dldMO (Fig. 3e–g, i–k and Supplementary Table 6), but an apparent recovery of HSCs had occurred by 4.5 d.p.f., when rag1 transcripts (revealing the thymic progeny of HSCs) were readily visible in both groups (Fig. 3m–o and Supplementary Table 6). Combinatorial reduction of Dlc and Dld activity, however, eliminated HSCs, as revealed by elimination of runx1 transcripts at 24 h.p.f. (Fig. 3h and Supplementary Table 6), cmyb transcripts at 36 h.p.f. (Fig. 3l and Supplementary Table 6) and rag1 transcripts at 4.5 d.p.f. (Fig. 3p and Supplementary Table 6). Thus, dlc and dld are combinatorially required for specification of HSCs in zebrafish, and their diminished expression in the somites of wnt16 morphant animals can, in principle, explain the observed loss of HSCs.

To confirm that the loss of HSCs in wnt16 morphants is due to loss of dlc and dld, we performed a rescue experiment. We injected embryos with W16MO, and in some cases co-injected mRNA encoding full-length Dlc and Dld ligands singly or in combination. Injection of dlc and dld mRNA alone or in combination did not have a strong effect on HSC numbers, as measured by runx1+ cells in the dorsal aorta (Fig. 3q–t, y). Co-injection of individual mRNAs with W16MO was unable to restore runx1 transcript levels (Fig. 3u–w, y). However, when injected together, dlc and dld restored runx1+ HSCs in a high percentage of W16MO-injected animals (Fig. 3x, y). These results confirm that decreased dlc and dld expression in wnt16 morphants is responsible for loss of HSCs.

Studies in zebrafish and mice have shown that Notch specification of HSCs is regulated by Shh and VegfA (ref. 1). Shh regulates the expression of vegfa, and VegfA signalling is, in turn, required for the vascular expression of Notch receptor genes1. Notch signalling is required for both arteriovenous and HSC specification1,20,21,22,23,24. In accord with these observations, loss of Shh signalling causes loss of both artery and HSCs1. Taken together, one level of control over HSC specification seems to be through a Shh/VegfA/Notch signalling pathway1. Shh/VegfA/Notch specification of HSCs seems to be distinct from Wnt16/Dlc/Dld effects because vascular and arterial specification is unaffected in W16MO animals (Fig. 2i–n and Supplementary Fig. 7a–d, o, p). Moreover, shha and Notch receptor expression are unaffected in W16MO animals (Fig. 2q, r and Supplementary Fig. 7a–l). To confirm that these pathways are discrete, we examined the expression of six known Shh target genes, with particular interest in vegfaa. None of the Shh targets examined showed significantly altered expression (Supplementary Fig. 14 and Supplementary Table 7). Our results indicate that the Wnt16 and Shh pathways act in parallel upstream of HSC specification.

The predominant model for how Notch signalling regulates HSC specification is that endothelial cells of the dorsal aorta receive a requisite Notch1-mediated signal1,21,22,23,24. Chimaeric mice generated using Notch1-deleted cells show no contribution of knockout cells to the adult haematopoietic system, demonstrating that Notch1 signalling is required cell-autonomously for specification of HSCs1,21. The relevant Notch ligand(s) are thought to be expressed in the formed dorsal aorta and/or immediately surrounding mesenchyme1,22,23,24. A contributing ligand seems to be Jag1, because Jag1-knockout mice have severely impaired, but not totally abrogated, development of HSCs1,24. Notch1 activation of Runx1 is thought to occur indirectly through Gata2, as the Runx1 promoter does not contain identifiable Rbpjκ binding sites1,21,23,24. Notch signalling defects in wnt16 morphants indicate that the requirement for Dlc and Dld is not the same as this cell-autonomous requirement, because decreased Notch ligand expression is specific to somites (Fig. 3a–d), whereas expression of dlc is normal in the dorsal aorta of wnt16 morphants (Supplementary Fig. 12 and Supplementary Table 5) and dld is not natively expressed near the formed dorsal aorta. Moreover, expression of jag1b and its putative target gata2 are unaffected in Wnt16 knock down animals (Fig. 4a–d).

To understand better whether Dlc/Dld specification of HSCs works cell-autonomously or not, we sought to define the timing of the Notch signalling event that is absent in W16MO-injected animals using animals carrying transgenes that allow heat-shock induction of the Notch intracellular domain (NICD), which is a dominant activator of the Notch pathway20,25. We induced NICD expression at different time points to identify the temporal window when enforced Notch activity could rescue HSC expression in wnt16 morphants. Nuclear, Myc-tagged NICD protein is present in transgenic animals by 1 h post heat shock, and is strong from 3 h post heat shock (Fig. 4e–h) through to at least 24 h post heat shock (not shown), consistent with previous reports26. Heat-shock induction of NICD at 14 h.p.f. (10-ss) rescued cmyb expression at 36 h.p.f. (Fig. 4i–k and Supplementary Table 8), as has been seen previously for rescue of mib20. Surprisingly, heat shock just 2 h later (14-ss) did not rescue cmyb expression along the dorsal aorta (red circle, Fig. 4l and Supplementary Table 8). These results indicate that the critical phase of Notch signalling required for HSC specification downstream of Wnt16 occurs between 15–17 h.p.f. (12–16-ss) and abruptly terminates by about 18–19 h.p.f. (18–20-ss).

Because this timing is well before the formation of the dorsal aorta and HSCs from its ventral endothelium, we sought to determine when cells fated to become HSCs first experience a cell-autonomous Notch signal. First, we used a tp1:Kaede Notch reporter line expressing a green-to-red, photoconvertible Kaede protein under the control of a Notch-responsive promoter. Photoconversion of Notch-responsive, Kaede + cells in the Dlc/Dld-critical window, before 19.5 h.p.f. (21-ss), yielded converted, red fluorescent progeny that contributed to the region near the dorsal aorta at 3 d.p.f. (left panels of Fig. 4m, n), but these cells never became HSCs, as shown by their failure to produce labelled thymic progeny (right panels of Fig. 4m, n). In contrast, photoconversion at 24 h.p.f. and later time points produced both labelled dorsal aorta (left panels of Fig. 4o, p) and thymic immigrants (right panels of Fig. 4o, p). Because there is a lag between reception of a Notch signal and the production of mature Kaede protein in the reporter lines, we wanted to confirm when Notch activity appears in pre-haematopoietic cells by a more immediate readout for Notch responsiveness. We performed double fluorescence in situ analysis in tp1:GFP Notch-reporter transgenic animals for expression of GFP and etsrp, which labels pre-haematopoietic mesoderm and is required for HSC specification27. The very first double-labelled cells appeared at 18 h.p.f. in the midline (Fig. 4q, r), and increased in number through to at least 24 h.p.f. (Fig. 4s, t). Taken together, our data indicate that Notch signalling in cells fated to become HSCs begins after 18 h.p.f. and continues well into the second day of development. This timing fits well with the established model of cell-autonomous Notch specification of HSCs, where Notch signalling in nascent HSCs occurs after aortic specification via interactions between Jag1b and Notch1 (refs 1, 21–24). Overall, our results indicate that somitic signalling by Dlc and Dld downstream of Wnt16 is temporally and spatially distinct from the observable cell-autonomous requirement for Notch signalling. Wnt16 therefore controls a previously unappreciated environmental requirement for Notch signalling in the somites, most simply explained by regulation of an unidentified relay signal.

To understand better what cell population Wnt16-regulated somitic Dlc and Dld act on, we examined fine somite patterning in Wnt16 and Dlc/Dld loss-of-function animals. Because somite segmentation (Figs 2a, b, e, f and 3a–d) and myotomal specification (Figs 2e, f and 3a–d) appear to be intact in wnt16 morphants, we examined specification of the sclerotomal somite compartment, which houses vertebral and vascular smooth muscle cell precursors. Sclerotomal markers displayed severely decreased expression, albeit to variable extents, in both W16MO and combined dlc/dld loss of function animals (Supplementary Fig. 15 and Supplementary Table 9). Although hypochord (Supplementary Fig. 15u–y, green arrowheads) was abolished in the dlc/dld double loss-of-function animals (Supplementary Fig. 15x), as has been reported18, hypochord was specified normally in wnt16 morphants (Fig. 2o, p and Supplementary Fig. 15y), emphasizing the fact that the Wnt16-dependent loss of somitic dlc/dld is distinct from global loss. Our results indicate that sclerotome specification or morphogenesis is required for HSC specification.

Our results demonstrate that non-canonical signalling by Wnt16 is required genetically upstream of the combined actions of the Notch pathway ligands Dlc and Dld for HSC specification. Dlc/Dld-mediated Notch signalling is spatially and temporally distinct from previously described cell-autonomous requirements for Notch in HSC specification, pointing to the possibility of a novel relay signal. These data represent the first demonstration, to our knowledge, that non-canonical Wnt signalling activity is required for HSC specification in vertebrates. Given that Wnt16 in mouse is expressed at similar times of development28 and is expressed in embryoid bodies during commitment to blood and vasculature29, it is feasible that this function is conserved in mammals.

Methods Summary

Zebrafish strains

The following strains were maintained in accordance with IACUC approved procedures: AB*, Tg(TOP:GFP) w25 , Tg(-6.0itga2b:eGFP) la2 , Tg(hsp70l:Gal4) 1.5kca4 , Tg(UAS:myc-Notch1a-intra) kca3 , Tg(tp1-MmHbb:EGFP) um14 , Tg(tp1-MmHbb:Kaede) um15 , Tg(cmyb:EGFP) zf169 , Tg(kdrl:RFP) la4 and dlctit446/tit446 .

Constructs

Probes and mRNA were synthesized from published constructs or cloned de novo according to standard procedures.

Morpholinos

The following morpholinos were used: 5 ng W16MO1 (AGGTTAGTTCTGTCACCCACCTGTC), W16MO2 (GCGTGGAATACTTACATCCAACTTC) and W16CoMO (AcGTTAGTTgTGTCAgCCAgCTcTC; lowercase letters denote mismatched bases).

Genotyping and PCR

Genotyping and PCR were performed by standard methods using primers and conditions described in Methods.

Whole-mount in situ, antibody staining and microscopy

These were performed according to standard methods and are described in full in Methods.

Online Methods

Zebrafish husbandry, microinjections and heat shock

Zebrafish strains AB*, Tg(TOP:GFP) w25 , Tg(-6.0itga2b:eGFP) la2 , Tg(hsp70l:Gal4) 1.5kca4 , Tg(UAS:myc-Notch1a-intra) kca3 , Tg(tp1-MmHbb:EGFP) um14 , Tg(tp1-MmHbb:Kaede) um15 , Tg(cmyb:EGFP) zf169 , Tg(kdrl:RFP) la4 and dlctit446/tit446 (S. Holley) were maintained, crossed, injected, raised and staged as described30, and in accordance with IACUC guidelines. The new line Tg(tp1-MmHbb:Kaede) um15 was generated by Tol2-mediated transgenic insertion of a transgene containing a previously described Notch-responsive promoter31 driving Kaede expression. Heat shocks were performed at the times indicated for 45 min at 37 °C, as previously described20.

Cloning, constructs and probes

Both zebrafish wnt16 isoforms (wnt16-001 and wnt16-002, Zebrafish Information Network (ZFIN)) were amplified from AB* embryo cDNA at tailbud, 9-somite and 24 h.p.f., using primers (5′ UTR-Wnt16-F CAGGTGCTACATATTAGATGCAGTGG, Wnt16-var.-F GACATGGATAATACCGGTTGTGGG, and zWnt16-R TTACTTGCAGGTGTGCATGTCATTC) designed based on GenBank sequences NM_207096 and CD751181.1 and cloned to pCRII-TOPO-TA (Invitrogen) according to the manufacturer’s instructions. Sequenced clones conform to subsequently deposited GenBank sequences NM_001100046.1 (wnt16-001) and BC066432.1 (wnt16-002), with no non-silent alterations. The wnt16-001 form was re-cloned using the primers ggatccGACATGGATAATACCGGTTGTG and ctcgagTTACTTGCAGGTGTGCATGTC to introduce 5′ BamH1 and 3′ Xho1 sites (PCR-added cut sites presented as lowercase in all primer sequences). Wnt16-001 and wnt16-002 sequences were subcloned to pCS2+ (ref. 32) via BamH1/Xho1 or EcoR1, respectively. Full-length dlc was amplified from 16-ss AB* cDNA using the primers dlc-F (ctcgagAAGATGGCTCGTGTTTTATTAAC) and dlc-R (tctagaCTATACCTCAGTAGCAAACACACG), TOPO-TA cloned, confirmed by sequencing, and subcloned to pCS2+. pCS2+ wnt3, pCS2+ dnfgfr1-eGfp (K. Poss) and pBS chd (D. Kimelman) were described previously14. The following probe and expression constructs were gifts as indicated: pCS2+ runx1 (C. Burns), pBK-CMV scl (L. Zon), pBK-CMV cmyb (L. Zon), pBS kdrl (D. Ransom), pBS gata1 (D. Ransom), pCS2+ gata2 (B. Paw), pCRII rag1 (N. Trede), pBS dlc (J. Lewis), pBS dld (B. Appel), pCS2+ dld (S. Holley), pBS jag1b (M. Pack), pBS jag2 (M. Pack), pCR-Script notch1a (J. Campos-Ortega), pCR-Script notch1b (M. Lardelli), pCR-Script notch2 (B. Appel), pCR-Script notch3 (M. Lardelli), pSPORT1 etsrp (S. Sumanas), pBS nkx2.2 (R. Karlström), pCRII gli1 (R. Karlström), pBS ptc2 (R. Karlström), pBS ptc1 (J. Waxman), pBS prdm1a (J. Waxman). The following probe constructs were amplified de novo and cloned to pCRII-TOPO-TA (Invitrogen) using primers as indicated: pCRII myod (myod-F AAGATGGAGTTGTCGGATATCC, myod-R AGAATTTTAAAGCACTTGATAAATGG), pCRII cdh5-frag (cdh5-probe-F TGCCTCCGACAAGGATGAAA, cdh5-probe-R ACCGAGGTCCCCACTCATGT), pCRII cdh17/cb903 (cb903/cdh17-F GCGGATGATACAGGAACAGG, cb903/cdh17-R CTGAAGGCAGATGAAGCCC), pCRII col2a1a-frag (col2a1a-probe-F CCACCTGGATTGACTGGACC, col2a1a-probe-R GTAGTGCTTGCATGTTCGGTC), pCRII vegfaa165 (vegfAa-long-F GTTAATTTTAGCGGATTCGACG, vegfAa-short-R GATCATCATCTTGGCTTTTCAC), pCRII shha (Bam-shha-F ggatccAAAATGCGGCTTTTGAC, shha-R1-R gaattcTCAGCTTGAGTTTACTGACATCC; subsequently subcloned to pCS2+), pCRII foxc1a (foxc1a-F GTCATGCAGGCGCGCTATT, foxc1a-R ctcgagTCAAAATTTGCTGCAGTCATACAC), pCRII foxc1b (foxc1b-F ggatccACGATGCAGGCGCGCTACCC, foxc1b-R TCAGAACTTGCTGCAGTCGTATAC), pCRII twist1b (twist1b-F GAGATGCCCGAAGAGCCCGCGC, twist1b-R ctcgagCTAGTGAGATGCAGACATGGACC), pCRII twist2 (twist2-F GAAATGGAAGAGAGTTCTAGCTC, twist2-R ctcgagCTAGTGGGACGCAGACATCG). A pax1 fragment corresponding exactly to the 1,080-bp open reading frame found in NM_001080592, which has been annotated as the zebrafish Pax1 orthologue at NCBI Homologene (HomoloGene:4514), was amplified (R1-pax1-F gaattcAAAATGCTTTCGTGTTTTGCAGAG, pax1-Xba-R tctagaTTACGAGGATGAGGTAGAAAGGC) from 24 h.p.f. AB* cDNA to generate pCRII pax1. The pax1 gene is located on chromosome 17 and shows syntenic conservation of the 5′ neighbour (Nkx2.2 in mouse and NKX2.2 in human). The encoded protein is 69% identical and 90% similar to mouse and human PAX1. A 5′ Xho1/Cla1 fragment of pBS efnb2a (gift of C. Moens) was re-cloned to pBS to generate pBS efnb2a-probe. Digoxigenin- and fluorescein-labelled probes were generated as described previously33 using 5′ cut sites and RNA polymerases as appropriate (details available on request). Embryos were mounted and photographed as described14.

mRNA, morpholinos and injections

5′-G-capped mRNAs were synthesized from Not1- or Asp718-(pCS2+ dlc) linearized pCS2+ constructs as described previously14, using the mMessage mMachinge kit (Ambion). The following morpholino antisense oligonucleotides were synthesized by Gene Tools, LLC and suspended as 25 mg ml−1 stocks in DEPC ddH2O and diluted to injection strengths: W16MO1 AGGTTAGTTCTGTCACCCACCTGTC, W16MO2 GCGTGGAATACTTACATCCAACTTC, W16CoMO2 (‘CoMO’ in the text) AcGTTAGTTgTGTCAgCCAgCTcTC, lowercase letters denote mismatched bases, dldMO2 AAACAGCTATCATTAGTCGTCCCAT (ref. 19), W11MO GAAAGTTCCTGTATTCTGTCATGTC (ref. 34). Injections were performed as described previously14, and 0.1% phenol red (Sigma Aldrich) was included as an indicator. W16MO1 and W16MO2 were injected individually at 5 ng and combinatorially at 2 ng W16MO1 plus 3 ng W16MO2. In all depicted cases, both morpholinos caused the representative phenotypes shown, thus embryos are labelled ‘W16MO’. A total of 5 or 7 ng of dldMO and W11MO were injected. 50 pg of dlc and/or dld mRNA were injected for rescue experiments.

Genomic and phylogenetic analyses

Alignments, genomic analyses and phylogenetic comparisons were performed as described previously14 using the following sequences: Wnt16l NP_001093516.1, mWnt16 NP_444346.3, hWNT16a NP_057171.2, hWNT16b NP_476509.1 and hWNT4 NP_110388.2 (as the outgroup). Sequencing analysis was performed with Sequencher software (GeneCodes Corp.).

PCR genotyping and RT–PCR

Fixed, WISH-processed individual embryos had DNA isolated in lysis buffer (10 mM Tris, pH 8.3, 50 mM KCl, 0.3% Tween-20, 0.3% NP-40), 98 °C, 10 min, held at 4 °C to allow addition of proteinase K to a final concentration of 1 mg ml−1, 18 h at 55 °C, 15 min at 98 °C. Presence of the UAS:NICD transgene was assessed by PCR using the primers E1B-F CATCGCGTCTCAGCCTCAC and Notch-R CGGAATCGTTTATTGGTGTCG (Tm 55 °C, extension time 45 s, 35 cycles), with ef-1α-F GTGCTGTGCTGATTGTTGCT, ef-1α-R TGTATGCGCTGACTTCCTTG as a positive control (Tm 56 °C, extension time 30 s, 25 cycles). For RT–PCR, RNA was isolated from groups of 30 whole embryos at the stages indicated, and cDNA prepared as described previously14. PCR on cDNA was amplified using the primers ef-1α (as above), wnt16-RT1-F ACTAAAGAGACAGCGTTCATCC, wnt16-RT1-R AACTCATCTTTGGTGATAGGC, wnt16-RT3-F TTGTGGGATACATGCAGTTCA and wnt16-RT3-R CACAGCTCCTTCTGCTTGTG with Taq polymerase (Invitrogen) at a Tm of 56 °C, extension times of 30 s, 38 cycles. Gels were imaged as described previously14.

Whole-mount in situ and antibody staining

Single and double enzymatic WISH was performed as described previously33. Double fluorescence in situs were performed according to published protocols18. Whole-mount immunofluorescence was performed as described35, using anti-Myc monoclonal 9E10 antibodies at 1:200 (Covance) and Dylight488 AffiniPure donkey anti-mouse IgG secondary antibodies (Jackson Immunoresearch Laboratories) at 1:100.

Confocal, fluorescence microscopy, photoconversion and time-lapse imaging

Confocal images were acquired, essentially as described7. Photoconversion of Kaede proteins was performed using the Leica SP5 ROI and bleach functions on whole embryos, excluding heads, using a 405-nm laser line for 2 min. Kaede fluorescence was visualized using 488-nm and 543-nm laser lines. Fluorescence images of transgenic animals were acquired on a Leica DMI 6000 (Leica Microsystem) and time-lapse images were analysed and processed using Volocity software (Perkin-Elmer) as described previously36.