In Extended Data Fig. 4d of this Letter, the immunofluorescence images (bottom row, experiments performed in the presence of the PARP inhibitor Olaparib) were inadvertently duplicated in panel e (bottom row, under the ‘PARP inhibitor’ heading). The corrected Extended Data Fig. 4e is shown as Supplementary Information to this Corrigendum, and this error does not alter the conclusions of the paper. In addition, in the ‘Oligonucleotides’ section of the Methods, the two oligonucleotides used for METTL14 should have been listed as: “sh 1, AGCATTGGTGCCGTGTTAAAT; or sh 2, GCTGACAGATTTGAAGAATAT.” We apologize for any inconvenience that these errors may have caused. The original Letter has not been corrected.
Additional information
The online version of the original article can be found at 10.1038/nature21671
Supplementary information
Supplementary Figure
This file contains the corrected Extended Data panel 4e and all the complete Extended Data figure 4a-f.
Rights and permissions
About this article
Cite this article
Xiang, Y., Laurent, B., Hsu, CH. et al. Correction: Corrigendum: RNA m6A methylation regulates the ultraviolet-induced DNA damage response. Nature 552, 430 (2017). https://doi.org/10.1038/nature24007
Published:
Issue Date:
DOI: https://doi.org/10.1038/nature24007
This article is cited by
-
The antagonistic effect of FTO on METTL14 promotes AKT3 m6A demethylation and the progression of esophageal cancer
Journal of Cancer Research and Clinical Oncology (2024)
-
FTO mediated ERBB2 demethylation promotes tumor progression in esophageal squamous cell carcinoma cells
Clinical & Experimental Metastasis (2022)
-
Potential roles of N6-methyladenosine (m6A) in immune cells
Journal of Translational Medicine (2021)
-
m5C modification of mRNA serves a DNA damage code to promote homologous recombination
Nature Communications (2020)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.