Abstract
To investigate the association between three selected pain polymorphisms and clinical, functional, sensory-related, psychophysical, psychological or cognitive variables in a sample of women with fibromyalgia (FMS). One hundred twenty-three (n = 123) women with FMS completed demographic (age, height, weight), clinical (years with pain, intensity of pain at rest and during daily living activities), functional (quality of life, physical function), sensory-related (sensitization-associated and neuropathic-associated symptoms), psychophysical (pressure pain thresholds), psychological (sleep quality, depressive and anxiety level) and cognitive (pain catastrophizing, kinesiophobia) variables. Those three genotypes of the OPRM1 rs1799971, HTR1B rs6296 and COMT rs4680 single nucleotide polymorphisms were obtained by polymerase chain reactions from no-stimulated whole saliva collection. No significant differences in demographic, clinical, functional, sensory-related, psychophysical, psychological and cognitive variables according to OPRM1 rs1799971, HTR1B rs6296 or COMT rs4680 genotype were identified in our sample of women with FMS. A multilevel analysis did not either reveal any significant gene-to-gene interaction between OPRM1 rs1799971 x HTR1B rs6296, OPRM1 rs1799971 x COMT rs4680 and HTR1B rs6296 x COMT rs4680 for any of the investigated outcomes. This study revealed that three single nucleotide polymorphisms, OPRM1 rs1799971, HTR1B rs6296 or COMT rs4680, mostly associated with chronic pain were not involved in phenotyping features of FMS. Potential gene-to-gene interaction and their association with clinical phenotype in women with FMS should be further investigated in future studies including large sample sizes.
Similar content being viewed by others
Introduction
Fibromyalgia syndrome (FMS) is a complex pain condition affecting up to 6% of the worldwide population1. Although the clinical presentation is well described in the literature2,3, its etiology is not completely understood. Patients with FMS generally report widespread pain, fatigue, sleep disorders, emotional problems, muscular weakness, cognitive impairments, exacerbated pain responses to painful and non-painful stimuli (defined as hypersensitivity or allodynia, respectively), and decreased physical capacity4. It appears the pathogenesis of FMS is complex and several aspects including altered nociceptive processing5, distress (e.g., catastrophism, pain hypervigilance, depression, anxiety, kinesiophobia)6 and neuropathic pain features7 interact at the same time8.
Another factor which may be involved in FMS is the presence of one or more genotypes in different single nucleotide polymorphisms9. In fact, more than 100 genes have potentially been involved in pain sensitivity and pain-related analgesia10. Among potential genes involved in chronic pain, the µ-opioid receptor (OPRM1) rs1799971, the 5-hydroxytryptamine receptor 1B (HTR1B) rs6296 and the catechol-O-methyltransferase (COMT) rs4680 polymorphisms have been proposed to be associated with FMS11,12.
The polymorphism OPRM1 rs1799971 results in a change of amino acid at position 40, in the first exon of the µ-opioid receptor protein from asparagine (Asn) to be replaced by aspartate acid (Asp). The presence of Asn or Asp allele determines the affinity for altered protein for β-endorphin, which represents a potential mechanism in which this polymorphism may alter pain sensitivity13. Ellerbrock et al. did not observe differences on pain sensitivity depending on the genotype of the OPRM1 rs1799971 polymorphism in people with FMS, although differences in cognitive brain areas were seen14. Solak et al.15 also did not observe an association between OPRM1 rs1799971 polymorphism and FMS in a Turkish population. On the contrary, Tour et al. identified that the presence of the Asp allele at the OPRM1 rs1799971 polymorphism was associated with decreased conditioned pain modulation16 and with exercise-induced hypoalgesia in an antagonist effect with the rs25531 polymorphism of the serotonin transporter (5-HTTLPR) gene in individuals with FMS17.
The HTR1B gene codifies the serotonergic receptor (5-HT1B) which is involved in physiological processes such as pain and sleep18. The polymorphism rs6296 results in a synonymous mutation causing a reduction of HTR1B mRNA18. Genotypes of the polymorphism rs6296 has been associated with a modulatory effect on exercise-induced hypoalgesia when combined with OPRM1 rs1799971 polymorphism in FMS17. No previous study has examined if particular genotypes of the HTR1B rs6296 polymorphism are associated with a higher risk of suffering FMS.
The Val158Met rs4680 polymorphism results in a substitution of valine (Val) to methionine (Met) in the product of the COMT gene at codon 15819 and is probably the genetic factor most frequently investigated in chronic pain conditions. This change causes the production of an enzyme with a lower thermostability (Met/Met genotype) resulting in decreased enzyme activity under physiological conditions19. Overall, it has been assumed that people with a Met/Met genotype tend to exhibit higher pain sensitivity than those with the Val/Val genotype19; however, it has been recently observed a high heterogeneity in this association supporting that the impact of the Val158Met rs4680 genotype on pain sensitivity is present when descending pain pathways are sufficiently impaired20. In fact, evidence about the association between the Val158Met rs4680 polymorphism and FMS is also conflicting since Lee et al.21 observed higher risk of FMS in carriers of the Met allele of the Val158Met rs4680 polymorphism whereas Zhang et al.22 did not find such association. Discrepancies in the association between the Val158Met rs4680 polymorphism and FMS continue in more recent studies23,24. The lack of a role of this gene on the risk of suffering from FMS does not exclude a potential influence on the clinical course and the severity of the disease. In fact, some studies have investigated the role of the Val158Met rs4680 polymorphism on related-disability25, pain sensitivity26,27 or mood disorders28 in FMS.
Collectively, these studies have enriched the understanding of FMS and endorse the genetic hypothesis as a contributor to the disease's development and severity, rather than to a higher risk of suffering from FMS25,26,27,28. Accordingly, given the multifactorial nature of FMS, additional research is warranted to explore the role of diverse genes that may impact disease chronicity and clinical features. Thus, this study aimed to investigate the association of OPRM1 rs1799971, HTR1B rs6296 and Val/Met COMT rs4680 polymorphisms with clinical, functional, sensory-related, psychophysical, psychological, and cognitive variables in a sample of women with FMS.
Methods
Participants
A consecutive sample of women with a diagnosis of FMS participated in this observational cross-sectional study. All participants were recruited from two associations of patients with FMS (AFINSYFACRO and FIBROPARLA Fibromyalgia Associations), located in Madrid (Spain). To be eligible, patients had to present with a medical diagnosis of FMS according to Wolfe et al. modified criteria29 and had to be able to read and sign a written informed consent prior to their inclusion in the study. Exclusion criteria included previous whiplash injury, presence of comorbid neuropathic pain (e.g., radiculopathy or myelopathy), had received previous major surgery, other underlying medical condition (e.g., rheumatoid arthritis) or take medication affecting muscle tone or pain perception. We permitted the symptomatic use of non-steroidal anti-inflammatory drugs at the time of the study. The study was approved by the Local Ethics Committee of Universidad Rey Juan Carlos (URJC 08-30-2020) and, in order to enhance the quality of the report, the STROBE guidelines were followed30.
Patient-reported outcome measures (PROMs)
Different PROMs including clinical, functional, sensory-related, cognitive, and psychological variables were collected in a structured questionnaire created for this study.
Clinical variables
The mean intensity of pain at rest, the worst level of pain at rest, and intensity of pain experienced during daily living activities were assessed in a 10-point (0: no pain, 10: maximum pain) Numerical Pain Rate Scale (NPRS)31.
Functional variables
The validated version of the Fibromyalgia Impact Questionnaire (FIQ, score: 0–100 points) in Spanish language, a specific-disease PROM for FMS, was used to assess pain-related disability32. The FIQ consists of 10 items (from 0 to 10 points) assessing the function on daily tasks, the number of days feeling good during the previous 7 days, pain interference at work, intensity of pain, fatigue, night resting, presence of stiffness, anxiety and depressive levels. Higher scores represent greater related-disability and pain severity32.
The paper-based five-level version of EQ-5D-5L questionnaire, a generic PROM consisting of five dimensions evaluated from 1 (no problem) to 5 (severe problems), was used to determine health-related quality of life33. Responses from the EQ-5D-5L are converted into a single index number between 0 (health state judged to be equivalent to death) and 1 (optimal health status) by applying crosswalk index values for the Spanish population33.
Sensory-related variables
The presence of sensitization-associated symptoms was assessed with the Spanish version of the Central Sensitization Inventory (CSI)34. This PROM uses 5-points Likert scale responses to identify the presence of sensitization-related symptoms. The cut-off for determining the presence of altered nociceptive pain processing has been set at 40 points out of total score of 100 points35.
The presence of neuropathic-associated pain symptomatology was assessed with the Spanish version of the Self-Report Leeds Assessment of Neuropathic Symptoms (S-LANSS) questionnaire36. This PROM identifies with acceptable sensitivity, internal consistency and validity whether a patient experiences pain symptom to be considered predominantly or non-predominantly of neuropathic origin36. From a total score of 24 points, scores higher than 12 points suggest the presence of neuropathic symptoms36.
Psychological variables
The Hospital Anxiety and Depression Scale (HADS) was used to evaluate the levels of anxiety (HADS-A, 7-items) and depression (HADS-D, 7-items) in our sample of FMS37. A score of 12 points out of 21 in the HADS-A and a score of 10 points out of 21 in the HADS-D suggests the presence of anxiety and depressive levels, respectively37.
The quality of sleep was assessed with the Pittsburgh Sleep Quality Index (PSQI)38. This PROM uses 4-point Likert-type scale responses evaluating different aspects of sleep, where 8 points out of a total score of 21 suggest poor sleep quality38.
Cognitive variables
The Spanish version of the Pain Catastrophizing Scale (PCS), a PROM consisting of 13 items answered in a 5-point Likert scale (total scores range from 0 to 52), was used to assess catastrophizing responses (e.g., rumination, magnification, and despair aspects)39.
Fear of movement perceived by the patient was assessed with the Spanish version of the 11-items short-form of the Tampa Scale for Kinesiophobia (TSK-11)40. This PROM includes 11 items assessing the attitude of the patient against pain answered with a 4-point Likert scale (1: “complete disagreement” to 4: “complete agreement”), leading to a score ranging from 0 to 44 points.
Pressure pain thresholds
Pressure pain thresholds (PPTs) were bilaterally assessed at the upper trapezius, second metacarpal and tibialis anterior muscle with an electronic algometer (Somedic AB©, Farsta, Sweden) to identify the presence of widespread pressure pain sensitivity as a clinical manifestation of altered nociceptive pain processing. Pressure was applied at a rate of approximately 30 kPa/s on each point, three times on each location with a 30-s resting period between measurements. For analyses, the mean score of the three trials on each point was calculated. This testing procedure has shown good reliability (ICC ≥ 0.88) in patients with FMS41.
DNA collection and genotyping
Unstimulated whole saliva samples were always collected during the morning into collection tubes according to standardized procedures. Participants were asked not to eat, drink or chew gum for 1 h before sample collection. The saliva samples were collected, stored and centrifuged at 3000 rpm for 15 min no later than 48 h after collection to obtain the cell sediment and stored at -20º C until the analysis. This process is the same as used in previous studies28,42.
Genomic DNA was extracted from 500 ml of saliva using a MagMAX™ DNA Multi-Sample Ultra 2.0 Kit (Thermo Fisher Scientific Inc, Hemel Hempstead, Hertfordshire, UK) according to the manufacturer’s protocol. We automatically extracted DNA using the King Fisher Flex purification robot (Thermo Fisher). The resulting DNA was assessed for purity and concentration using Quant-iT™ PicoGreen™ dsDNA reagent" (Thermo Fisher). The resulting DNA was diluted to 5 ng/μl, using 1 × Tris‐EDTA (TE) buffer (Sigma‐Aldrich, Dorset, UK). The qPCR reaction mixtures of 10ul contained a total of 10 ng gDNA as a PCR template, 1 × TaqMan Gene Expression PCR Master Mix and 0.6 × Genotyping TaqMan-probe assay.
For genotyping single nucleotide polymorphisms (SNP) with Real-Time PCR reaction TaqMan® Assay ID C_25746809_50 Predesigned SNP Genotyping Assays was used (Thermo Fisher Scientific Inc, Hemel Hempstead, Hertfordshire, UK). TaqMan® SNP Genotyping Assays use TaqMan® 5’‐nuclease chemistry for amplifying and detecting specific alleles of each SNP in purified genomic DNA samples. Each assay allows the genotyping of individuals for a single nucleotide polymorphism. Real-time PCR plates were run in the Quantstudio 12 K Flex System (Thermo Fisher) of Genomics Unit (Madrid Science Park Foundation, Spain) under standard running conditions (95° for 10 min and 40 two-step cycles consisting of 95 °C for 15 s and 60 °C for 1 min) and analyzed with Genotyping App of Thermo Fisher Cloud. Identification of each of the three possible variants of each single nucleotide polymorphism was conducted by using specific fluorescent dyes.
The possible variants of the OPRM1 rs1799971 polymorphism lead to the following genotypes: Asn/Asn (A/A), Asn/Asp (A/G) or Asp/Asp (G/G). The results were derived from a A → G substitution at the following sequence:
GGTCAACTTGTCCCACTTAGATGGC [A/G] ACCTGTCCGACCCATGCGGTCCGAA
The variants of the HTR1B rs6296 polymorphism lead to the following genotypes: C/C, C/G or G/G. The results were derived from a C → G substitution at the sequence:
CGGAGACTCGCACTTTGACTTGGTT [C/G] ACATACACAGGAGATCCGGATTCGC
The possible variants of the COMT rs4680 polymorphism lead to the following three genotypes: Val/Val (G/G), Val/Met (G/A), Met/Met (A/A). The results were derived from A → G substitution at the following sequence:
CCAGCGGATGGTGGATTTCGCTGGC [G/A] TGAAGGACAAGGTGTGCATGCCTGA.
Statistical analysis
Statistical analyses were performed using SPSS Statistics, version 25.0. Data were expressed as mean ± standard deviation (SD). The chi-squared (χ2) test was used to assess potential deviations from Hardy–Weinberg equilibrium. The Shapiro–Wilk test revealed that data exhibited normal distribution, hence, parametric tests were used. First, separate analyses of variance (ANOVA) were used to assess differences in clinical, functional, sensory-related, cognitive, and psychological variables according to the genotype of each polymorphism (OPRM1 rs1799971, HTR1B rs6296, COMT rs4680). Second, multilevel analysis of variance (MANOVA) including all polymorphisms (OPRM1 rs1799971, HTR1B rs6296, COMT rs4680) was also conducted to identify the possible interaction between all combinations of genotypes in the outcomes. Due to the inclusion of several variables, we applied correction by multiple testing considering a Bonferroni-corrected alpha of 0.0125 (4 time points).
Ethical approval
The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Clinical Ethics Committee of Universidad Rey Juan Carlos (URJC 08–30-2020). Written informed consent was obtained from all subjects involved in the study.
Results
From 140 Caucasian women with a diagnosis of FMS screened for eligible criteria, 14 (10%) were excluded due to previous major surgery (n = 8), previous whiplash (n = 4), and pregnancy (n = 2), leading to a final sample of 126 patients (mean age: 52 ± 9.9 years old). Three saliva samples were undetermined during genotyping analysis for the investigated SNPs and, accordingly, were excluded from the analysis providing a sample of 123 women with FMS with the complete data (Table 1).
The Asn/Asn genotype of the OPRM1 rs1799971 polymorphism was the most prevalent (63.4%), followed by the Asn/Asp (31.7%) and the Asp/Asp (4.9%) genotypes (Table 2). Thus, the Asn allele was present in 79.2% (n = 195/246) whereas the Asp allele was present in the remaining 20.8% (n = 51/246) of the sample. This genotype/allele distribution of the OPRM1 rs1799971 polymorphism did not deviate from that expected based on the Hardy–Weinberg equilibrium (chi square = 0.153).
The ANOVA did not reveal any significant difference in demographic (age, height, weight), clinical (pain history, mean pain, worst pain, pain on daily activities) functional (FIQ, EQ-5D-5L), sensory-related (CSI, S-LANSS), PPTs (upper trapezius, second metacarpal, tibialis anterior), psychological (HADS-A, HADS-D, PSQI), and cognitive (PCS, TSK-11) variables depending on the OPRM1 rs1799971 genotype (Table 2).
The C/C genotype of the HTR1B rs6296 polymorphism was present in 51.2% (n = 63) of the sample, whereas the C/G and G/G genotypes were present in 41.4% (n = 51) and 7.4% (n = 9) of the sample (Table 3). Thus, the C allele was present in 71.9% (n = 177/246) whereas the G allele was present in the remaining 28.1% (n = 69/246) of the sample. This genotype/allele distribution of the HTR1B rs6296 polymorphism did not deviate from that expected based on the Hardy–Weinberg equilibrium (chi square = 0.091).
Again, no significant difference in demographic (age, height, weight), clinical (pain history, mean pain, worst pain, pain on daily activities) functional (FIQ, EQ-5D-5L), sensory-related (CSI, S-LANSS), psychophysical (PPT upper trapezius, PPT second metacarpal, PPT tibialis anterior), psychological (HADS-A, HADS-D, PSQI), and cognitive (PCS, TSK-11) variables were identified depending on the HTR1B rs6296 genotype (Table 3).
The Val/Val genotype of the COMT rs4680 polymorphism was present in 27.6% (n = 34) of the sample, whereas the Val/Met and Met/Met genotypes were present in 49.7% (n = 61) and 22.7% (n = 28) of the sample, respectively (Table 3). Thus, the Val allele was present in 52.4% (n = 129/246) whereas the Met allele was present in the remaining 47.6% (n = 117/246) of the sample. This genotype and allele distribution of the COMT rs4680 polymorphism deviated from that expected based on the Hardy–Weinberg equilibrium (chi square = 0.042).
The ANOVA did not either reveal any significant difference in demographic (age, height, weight), clinical (pain history, mean pain, worst pain, pain on daily activities) functional (FIQ, EQ-5D-5L), sensory-related (CSI, S-LANSS), PPTs (upper trapezius, second metacarpal, tibialis anterior), psychological (HADS-A, HADS-D, PSQI), and cognitive (PCS, TSK-11) variables depending on the COMT rs4680 genotype (Table 4).
Finally, the multivariate analysis did not reveal any statistical significant gene-to-gene interactions between OPRM1 rs1799971 x HTR1B rs6296, OPRM1 rs1799971 x COMT rs4680 and HTR1B rs6296 x COMT rs4680 for any of the investigated outcomes.
Discussion
This study examined the role of three polymorphisms, i.e., OPRM1 rs1799971, HTR1B rs6296 and COMT rs4680, commonly related to chronic pain within the clinical phenotype in women with FMS. Current results revealed that the OPRM1 rs1799971, HTR1B rs6296 and COMT rs4680 were not overall involved in phenotyping features of FMS related-pain.
OPRM1 gene and fibromyalgia
Previous research has found that healthy people with the Asp allele exhibit lower pressure pain sensitivity compared with those carrying the Asn allele associated with the OPRM1 rs1799971 polymorphism43. This change is related to an alteration of the µ-opioid receptor, reducing or eliminating a putative site for N-linked glycosylation, leading to potentially altered interaction with β-endorphins43. In the current study, genotypes associated with the OPRM1 rs1799971 polymorphism did not show association with any of the investigated variables in our sample of women with FMS. Further, a previous study did not either find an association between OPRM1 rs1799971 polymorphism and a higher risk of developing FMS15. Current and previous findings would suggest that OPRM1 rs1799971 polymorphism genotypes are not related to pain in a specific chronic condition such as FMS. It is possible a potential effect of different or more than one type of opioid receptor, or a gene-to-gene interaction of this polymorphism in the clinical phenotype in women with FMS.
HTR1B gene and fibromyalgia
Similarly, we also observed that HTR1B rs6296 polymorphism, involved in the regulation of serotonin levels by inducing a synonymous mutation on the Val in position 28718, was not either associated with the clinical phenotype in women with FMS when investigated in isolation. Although this polymorphism has been associated with mental problems44, we did not either find significant differences in psychological or cognitive variables according to its genotypes. However, we do not know if other mental problems, such as suicide ideation45 or the presence of post-traumatic stress disorder (PTSD)46, which are commonly seen in FMS, would be associated with these polymorphisms in this population.
COMT gene and fibromyalgia
The Val158Met rs4680 is the polymorphism most investigated in FMS; however, its association with a higher risk of suffering this condition is controversial21,22,23,24. The Met allele of this polymorphism results in an increased degradation of neurotransmitters such as dopamine, norepinephrine or epinephrine and, therefore, a reduction of these neurotransmitters at synaptic receptors19. We observed that women with FMS carrying the Met/Met genotype tend to report longer pain history, lower function and sensitization -associated symptoms than those with the other genotypes; however, differences did not reach the statistical significance. Our results disagree with previous studies showing that patients with FMS and Met/Met carriers exhibit higher related-disability25 and worse psychological aspects28. Similarly, an association with higher pain sensitivity, as a manifestation of central sensitization has been also associated with the Met/Met genotype in previous studies26,27. Nevertheless, it is important to consider that COMT variation has long been known to be more complex than the single Val/Met polymorphism and studies looking at haplotypes of multiple SNPs are now necessary to account for this complexity.
Other polymorphisms and fibromyalgia
The fact that the investigated polymorphisms are not related to the pain phenotype or a higher risk of suffering a particular condition, in such a case FMS, does not exclude a genetic component in this pain condition. For instance, a comprehensive genome-wide investigation underscored that immediate family members are more susceptible to FMS, bolstering the assumption of a genetic foundation47. Potential genes accountable for pain susceptibility in FMS are the serotonin transporter gene (SLC64A4) and the transient receptor potential vanilloid 2 (TRPV2) gene48. In fact, SLC64A4, marked by a single nucleotide polymorphism, has been linked to chronic pain conditions such as temporo-mandibular pain as well as to elevated depression levels, and psychological disorders due to changes in serotonin reuptake49. Similarly, TRPV2 gene, which is expressed in mechano- and thermo-responsive neurons in the dorsal root and trigeminal ganglia, could be associated with the decreased pain thresholds observed in patients with FMS11.
It is also possible that other type of genetic analysis, such as DNA methylation, could reveal potential association between different genes and FMS. In fact, GRM2 methylation has revealed that this gene plays a relevant role in FMS patients since it causes an increase of cerebrospinal fluid glutamate levels48. Therefore, future studies investigating the association of these genes with the clinical phenotype in people with FMS are needed.
Limitations
Finally, it is important to note some potential limitations to the current study. First, the sample only included women with FMS. Hence, extrapolation of these results to men with FMS should not be done. Therefore, investigating sex differences in future studies is needed. In addition, all participants were Caucasian, so we were not able to investigate the role of race or ethnicity in genetics. Lee et al. found that African-Americans were more likely to exhibit a Met/Met genotype than other ethnics, regardless of the diagnosis of FMS24. Thus, by excluding individuals with FMS taking analgesic drugs (aside from NSAIDs), we could unintentionally excluded patients with more pain and pain-related comorbidities. Accordingly, our results should be considered according to the features of our sample. Second, the sample size could be considered relatively small, and we did not conduct “a priori” sample size calculation leading to the identification of small samples (n = 6 or n = 9) in some allele homozygote genotypes which could be quite underpowered. Third, we did not include a control group; nevertheless, since we assessed the phenotype of a chronic pain condition, the inclusion of a pain-free control group would have not permitted assessment of these pain-related outcomes. Finally, we only assessed three polymorphisms associated with altered nociceptive processing. Future studies should investigate the influence of different polymorphisms, in addition to other genes in the clinical phenotype of this condition.
Conclusion
This study examined the role of three polymorphisms, i.e., OPRM1 rs1799971, HTR1B rs6296 and COMT rs4680, commonly related to chronic pain within the clinical phenotype in women with FMS. Current results revealed that the OPRM1 rs1799971, HTR1B rs6296 and COMT rs4680 were not overall involved in phenotyping features of FMS related-pain. Future studies including large sample sizes and a greater number of polymorphisms are needed.
Data availability
All data derived from this study are presented in the text. Data are available from the corresponding author upon reasonable request.
References
Marques, A. P., Santo, A. S. D. E., Berssaneti, A. A., Matsutani, L. A. & Yuan, S. L. K. Prevalence of fibromyalgia: Literature review update. Rev. Bras. Reumatol. Engl. Ed. 57(4), 356–363. https://doi.org/10.1016/j.rbre.2017.01.005 (2017).
Sarzi-Puttini, P., Giorgi, V., Marotto, D. & Atzeni, F. Fibromyalgia: an update on clinical characteristics, etiopathogenesis and treatment. Nat. Rev. Rheumatol. 16(11), 645–660. https://doi.org/10.1038/s41584-020-00506-w (2020).
Häuser, W., Sarzi-Puttini, P. & Fitzcharles, M. A. Fibromyalgia syndrome: under-, over- and misdiagnosis. Clin. Exp. Rheumatol. 37(Suppl 116), 90–97 (2019).
Berwick, R., Barker, C. & Goebel, A. Guideline development group. The diagnosis of fibromyalgia syndrome. Clin. Med. 22(6), 570–574. https://doi.org/10.7861/clinmed.2022-0402 (2022).
Valera-Calero, J. A. et al. Convergent validity of the central sensitization inventory in women with fibromyalgia: Association with clinical, psychological and psychophysical outcomes. Eur J Pain. 26(10), 2141–2151. https://doi.org/10.1002/ejp.2026 (2022).
Liew, B. X. W. et al. Distress and sensitization as main mediators of severity in women with fibromyalgia: A structural equation model. Biomedicines. 10(5), 1188. https://doi.org/10.3390/biomedicines10051188 (2022).
Úbeda-D’Ocasar, E. et al. Association of neuropathic pain symptoms with sensitization related symptomatology in women with fibromyalgia. Biomedicines. 10(3), 612 (2022).
Valera-Calero, J. A., Arendt-Nielsen, L., Cigarán-Méndez, M., Fernández-de-las-Peñas, C. & Varol, U. Network analysis for better understanding the complex psycho-biological mechanisms behind fibromyalgia syndrome. Diagnostics 12(8), 1845. https://doi.org/10.3390/diagnostics12081845 (2022).
Siracusa, R., Paola, R. D., Cuzzocrea, S. & Impellizzeri, D. Fibromyalgia: Pathogenesis, mechanisms, diagnosis and treatment options update. Int. J. Mol. Sci. 22(8), 3891. https://doi.org/10.3390/ijms22083891 (2021).
Kouraki, A. et al. Different genes may be involved in distal and local sensitization: A genome-wide gene-based association study and meta-analysis. Eur. J. Pain. 26(3), 740–753. https://doi.org/10.1002/ejp.1902 (2022).
Ablin, J. N. Buskila D Update on the genetics of the fibromyalgia syndrome. Best Pract. Res. Clin. Rheumatol. 29(1), 20–28. https://doi.org/10.1016/j.berh.2015.04.018 (2015).
D’Agnelli, S. et al. Genetics and epigenetics insights may provide the basis for the development of diagnostic biomarkers. Mol. Pain. 15, 1744806918819944 (2019).
Haerian, B. S. & Haerian, M. S. OPRM1 rs1799971 polymorphism and opioid dependence: Evidence from a meta-analysis. Pharmacogenomics. 14(7), 813–824. https://doi.org/10.2217/pgs.13.57 (2013).
Ellerbrock, I. et al. Polymorphisms of the μ-opioid receptor gene influence cerebral pain processing in fibromyalgia. Eur. J. Pain. 25(2), 398–414. https://doi.org/10.1002/ejp.1680 (2021).
Solak, Ö. et al. Assessment of opiod receptor μ1 gene A118G polymorphism and its association with pain intensity in patients with fibromyalgia. Rheumatol. Int. 34(9), 1257–1261. https://doi.org/10.1007/s00296-014-2995-1 (2014).
Tour, J., Sandström, A., Kadetoff, D., Schalling, M. & Kosek, E. The OPRM1 gene and interactions with the 5-HT1a gene regulate conditioned pain modulation in fibromyalgia patients and healthy controls. PLoS One. 17(11), e0277427. https://doi.org/10.1371/journal.pone.0277427 (2022).
Tour, J. et al. Gene-to-gene interactions regulate endogenous pain modulation in fibromyalgia patients and healthy controls-antagonistic effects between opioid and serotonin-related genes. Pain. 158(7), 1194–1203. https://doi.org/10.1097/j.pain.0000000000000896 (2017).
Xia, X. et al. Effects of HTR1B 3’ region polymorphisms and functional regions on gene expression regulation. BMC Genet. 21, 79. https://doi.org/10.1186/s12863-020-00886-8 (2020).
Tammimäki, A. & Männistö, P. T. Catechol-O-methyltransferase gene polymorphism and chronic human pain: A systematic review and meta-analysis. Pharmacogenet. Genomics. 22(9), 673–691. https://doi.org/10.1097/FPC.0b013e3283560c46 (2012).
Vetterlein, A., Monzel, M. & Reuter, M. Are catechol-O-methyltransferase gene polymorphisms genetic markers for pain sensitivity after all? A review and meta-analysis. Neurosci. Biobehav. Rev. 148, 105112. https://doi.org/10.1016/j.neubiorev.2023.105112 (2023).
Lee, Y. H., Kim, J. H. & Song, G. G. Association between the COMT Val158Met polymorphism and fibromyalgia susceptibility and fibromyalgia impact questionnaire score: A meta-analysis. Rheumatol. Int. 35(1), 159–166. https://doi.org/10.1007/s00296-014-3075-2 (2015).
Zhang, L., Zhu, J., Chen, Y. & Zhao, J. Meta-analysis reveals a lack of association between a common catechol-O-methyltransferase (COMT) polymorphism Val158Met and fibromyalgia. Int. J. Clin. Exp. Pathol. 7(12), 8489–8497 (2014).
Hatami, M. et al. Association of catechol-O-methyltranferase 472G>A (Val158Met) polymorphism with susceptibility to fibromyalgia syndrome. J. Orthop. 20, 257–260. https://doi.org/10.1016/j.jor.2020.01.013 (2020).
Lee, C., Liptan, G., Kantorovich, S., Sharma, M. & Brenton, A. Association of Catechol-O-methyltransferase single nucleotide polymorphisms, ethnicity, and sex in a large cohort of fibromyalgia patients. BMC Rheumatol. 2, 38. https://doi.org/10.1186/s41927-018-0045-4 (2018).
Estévez-López, F. et al. Interplay between genetics and lifestyle on pain susceptibility in women with fibromyalgia: The al-Ándalus project. Rheumatology 61(8), 3180–3191. https://doi.org/10.1093/rheumatology/keab911 (2022).
Desmeules, J. et al. Central pain sensitization, COMT Val158Met polymorphism, and emotional factors in fibromyalgia. J. Pain. 15(2), 129–135. https://doi.org/10.1016/j.jpain.2013.10.004 (2014).
Martínez-Jauand, M. et al. Pain sensitivity in fibromyalgia is associated with catechol-O-methyltransferase (COMT) gene. Eur. J. Pain. 17(1), 16–27. https://doi.org/10.1002/j.1532-2149.2012.00153.x (2013).
Fernández-de-las-Peñas, C., Ambite-Quesada, S., Gil-Crujera, A., Cigarán-Méndez, M. & Peñacoba-Puente, C. Catechol-O-methyltransferase Val158Met polymorphism influences anxiety, depression, and disability, but not pressure pain sensitivity, in women with fibromyalgia syndrome. J. Pain. 13(11), 1068–1074. https://doi.org/10.1016/j.jpain.2012.08.001 (2012).
Wolfe, F. et al. 2016 Revisions to the 2010/2011 fibromyalgia diagnostic criteria. Semin. Arthritis Rheum. 46(3), 319–329. https://doi.org/10.1016/j.semarthrit.2016.08.012 (2016).
Cuschieri, S. The STROBE guidelines. Saudi J Anaesth. 13(Suppl 1), S31–S34. https://doi.org/10.4103/sja.SJA_543_18 (2019).
Cheatham, S. W., Kolber, M. J., Mokha, M. & Hanney, W. J. Concurrent validity of pain scales in individuals with myofascial pain and fibromyalgia. J. Bodyw. Mov. Ther. 22(2), 355–360. https://doi.org/10.1016/j.jbmt.2017.04.009 (2018).
Rivera, J. & González, T. The Fibromyalgia Impact Questionnaire: a validated Spanish version to assess the health status in women with fibromyalgia. Clin. Exp. Rheumatol. 22, 554–560 (2004).
Herdman, M. et al. Development and preliminary testing of the new five-level version of EQ-5D (EQ-5D-5L). Qual. Life. Res. 20, 1727–1736. https://doi.org/10.1007/s11136-011-9903-x (2011).
Cuesta-Vargas, A. I., Roldan-Jimenez, C. & Neblett, R. Gatchel RJ Cross-cultural adaptation and validity of the Spanish Central Sensitization Inventory. Springerplus. 5(1), 1837. https://doi.org/10.1186/s40064-016-3515-4 (2016).
Neblett, R. et al. The Central Sensitization Inventory (CSI): establishing clinically significant values for identifying central sensitivity syndromes in an outpatient chronic pain sample. J Pain 14(5), 438–445. https://doi.org/10.1016/j.jpain.2012.11.012 (2013).
López-de-Uralde-Villanueva, I. et al. Validity and reliability of the Spanish-language version of the self-administered leeds assessment of neuropathic symptoms and signs (S-LANSS) pain scale. Neurologia (Engl Ed). 33(8), 505–514. https://doi.org/10.1016/j.nrl.2016.10.009 (2018).
Bjelland, I., Dahl, A. A., Haug, T. T. & Neckelmann, D. The validity of the hospital anxiety and depression scale. An updated literature review. J. Psychosom. Res. 52(2), 69–77. https://doi.org/10.1016/s0022-3999(01)00296-3 (2002).
Fabbri, M. et al. Measuring subjective sleep quality: A Review. Int. J. Environ. Res. Public Health. 18(3), 1082. https://doi.org/10.3390/ijerph18031082 (2021).
García Campayo, J. et al. Validation of the Spanish version of the Pain Catastrophizing Scale in fibromyalgia. Med. Clin. (Barc). 131(13), 487–492. https://doi.org/10.1157/13127277 (2008).
Gómez-Pérez, L., López-Martínez, A. E. & Ruiz-Párraga, G. T. Psychometric properties of the Spanish Version of the Tampa Scale for Kinesiophobia (TSK). J Pain. 12(4), 425–435. https://doi.org/10.1016/j.jpain.2010.08.004 (2011).
Cheatham, S. W., Kolber, M. J., Mokha, G. M. & Hanney, W. J. Concurrent validation of a pressure pain threshold scale for individuals with myofascial pain syndrome and fibromyalgia. J. Man. Manip. Ther. 26, 25–35. https://doi.org/10.1080/10669817.2017.1349592 (2018).
Fernández-de-las-Peñas, C. et al. Are pain polymorphisms associated with the risk and phenotype of post-COVID pain in previously hospitalized COVID-19 survivors?. Genes (Basel). 13(8), 1336. https://doi.org/10.3390/genes13081336 (2022).
Fillingim, R. B. et al. The A118G single nucleotide polymorphism of the μ-opioid receptor gene (OPRM1) is associated with pressure pain sensitivity in humans. J Pain 6(3), 159–167. https://doi.org/10.1016/j.jpain.2004.11.008 (2005).
Yang, P. et al. A meta-analysis of 5-Hydroxytryptamine receptor 1B polymorphisms with risk of major depressive disorder and suicidal behavior. Front Psychiatry. 12, 696655. https://doi.org/10.3389/fpsyt.2021.69665 (2021).
Adawi, M. et al. Suicidal behavior in fibromyalgia patients: rates and determinants of suicide ideation, risk, suicide, and suicidal attempts: A systematic review of the literature and meta-analysis of over 390,000 fibromyalgia patients. Front Psychiatry. 12, 629417. https://doi.org/10.3389/fpsyt.2021.629417 (2021).
Kaleycheva, N. et al. The role of lifetime stressors in adult fibromyalgia: systematic review and meta-analysis of case-control studies. Psychol Med. 51(2), 177–193. https://doi.org/10.1017/S0033291720004547 (2021).
Arnold, L. M. et al. The fibromyalgia family study: a genome-wide linkage scan study. Arthritis Rheum. 65(4), 1122–1128. https://doi.org/10.1002/art.37842 (2013).
Mergener, M., Becker, R. M., dos Santos, A. F., dos Santos, G. A. & de Andrade, F. M. Influence of the interaction between environmental quality and T102C SNP in the HTR2A gene on fibromyalgia susceptibility. Rev Bras Reumatol. 51(6), 594–602 (2011).
Gerra, M. C. et al. DNA methylation changes in fibromyalgia suggest the role of the immune-inflammatory response and central sensitization. J. Clin. Med. 10, 4992. https://doi.org/10.3390/jcm10214992 (2021).
Author information
Authors and Affiliations
Contributions
All the authors cited in the manuscript had substantial contributions to the concept and design, the execution of the work, or the analysis and interpretation of data; drafting or revising the manuscript and have read and approved the final version of the paper.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Fernández-de-las-Peñas, C., Ambite-Quesada, S., Fernández-Méndez, L.M. et al. Association of OPRM1 rs1799971, HTR1B rs6296 and COMT rs4680 polymorphisms with clinical phenotype among women with fibromyalgia. Sci Rep 14, 11273 (2024). https://doi.org/10.1038/s41598-024-62240-7
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-024-62240-7
Keyword
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
