Introduction

Mental health and its contributing factors have been increasingly studied by health researchers in the post-coronavirus era. The importance of accurate knowledge of the factors that prevent the development of depression, stress, and anxiety has become more obvious. Research in this field is important because it can reduce the burden of long-term treatment costs for these patients on the health system1. Research published before the spread of the coronavirus reported that the prevalence of anxiety and depression was 7.3% and 4.7% of the world’s population, respectively. However, this research did not take into account national quarantines’ outcomes on mental health. Therefore, it is important to pay attention to all aspects affecting mental health2. Obese women are twice as likely to be diagnosed with depression and anxiety disorders compared to obese men3. Women who are overweight also have a higher risk of depression than those with normal weight4. In recent decades, societies have become industrialized and people have migrated to cities, causing significant changes in people’s lifestyles and the environment. However, our genetic changes have not adapted to these changes and remain an evolutionary mismatch5. Unhealthy eating is one of the most obvious consequences of modern life and is the cause of many non-communicable and mental diseases6. The importance of dietary factors is such that according to research in 2017, nutritional risks were placed at level 2 for risk factors of mortality7. Due to changes in lifestyle and diet over the past centuries, the percentage of intake of many fatty acids has changed significantly. According to research, in the United States of America, the daily intake of omega-6 linoleic acid has increased from 3% of total energy intake to more than 7%8. According to meta-analysis conducted by Zhang and et al. the amount of omega-3 intake has a significant effect on reducing stress and depression9. Changes in the ratio of omega-6 to omega-3 can affect mental health. Although many studies support the theory of PUFA consumption, especially omega-3, as reducing depression, clinical trials have also been conducted that have not observed significant effect10,11.

Based on the previous statements, it can be assumed that genes affecting lipid homeostasis may also have indirect effects on people’s mental health. The melanocortin-4 receptor (MC4R) gene is involved in regulating energy homeostasis and has been linked to obesity and metabolic consequences12. A study published in 2011 found that a variant near the MC4R gene regulates triglyceride levels13. Also Caveolin-1 (Cav-1) controls the metabolism of lipid droplets in endothelial cells by stimulating autocrine prostacyclin and cAMP-mediated lipolysis. Lipid droplets (LD) are organelles that are involved in intracellular lipid metabolism in almost all eukaryotic cells, and their dynamics are tightly regulated by proteins associated with them14. Given the importance of mental health to society and the possibility of indirect effects of these genes on mental health, further research is needed to investigate these connections.

Methods

Study population

This study was conducted in Tehran, Iran and included 378 women who were overweight or obese. The subjects were between the ages of 18–68 and had a body mass index (BMI) of 25–40 kg/m2. Women who were pregnant or at menopause, lactating, smoking, dieting, taking weight loss supplements, antipsychotics, antihypertensives, or lowering glucose or lipid levels were excluded from the study. Women with malignancies, depression, diabetes, liver disease, kidney disease, cardiovascular disease or other chronic or acute diseases were also excluded. The study was approved by the Ethics Committee of the Tehran University of Medical Sciences (TUMS) and received ethical approval (assigned number: IR.TUMS.MEDICINE.REC.1401.504). Overweight and obese women were recruited from all regional health centers (n = 20) in western and central Tehran using a community-based multistage simple random sampling method. Participants were chosen at random from Tehran health centers if they met the criteria for inclusion in the study. The participants’ variables were classified according to N6/N3 and CSI quartiles, with Q1 and Q4 being the lowest and highest quartiles of N6/N3 and CSI, respectively.

Sociodemographic and blood pressure measurements

The study used a standard sociodemographic questionnaire to assess employment, education level, marital and economic status, and supplement intake. The participants’ weight, BMI, and body fat percent (BF%) were analyzed using a bioelectrical impedance analyzer (BIA) (InBody 770 scanner, Seoul, Korea)15. Height was measured using a non-elastic tape and waist circumference (WC) and the hip circumference (HC) was measured using an elastic tape. The waist-to-hip ratio (WHR) is calculated by dividing the WC by the hip circumference (HC). Blood pressure was measured twice with an appropriate cuff after 5 min of rest and the mean value was recorded. Physical activity levels of the participants were gathered using the short form of a reliable and validated international physical activity questionnaire (IPAQ)16. Metabolic equivalent hours per week (METs-h/week) were measured for each subject during the previous week.

Biochemical variables

For venous blood sampling, the patients came to the center after fasting for 10 h, and after collecting and centrifuging the serum, it was kept at a temperature of –80 °C. In the biochemistry laboratory located in the University of Nutrition and Dietetics, standard methods were used to evaluate the collected samples. The glycerol-3-phosphate oxidase-phenol 4-aminoantipyrine peroxidase (GPOPAP) enzymatic method was used to measure TG and TC. And the amount of HDL was also measured after the precipitation of lipoproteins containing apo B Also, LDL was measured by direct enzymatic method, and to measure insulin from the Access Chemiluminescent Immunoassay method. Using the homeostatic model evaluation formula (HOMA), the index of insulin resistance was evaluated \(\frac{\mathrm{fasting plasma glucose }\times \mathrm{fasting serum insulin}}{405}\).

Mental health assessment

The mental health status of participants was evaluated using the DASS-21 questionnaire, which is a short version of a 42-item self-report instrument designed to measure three related negative emotional states: depression, anxiety, and tension/stress. It consists of three self-report scales that are used to measure the emotional states of depression, anxiety, and stress. Each of the three DASS-21 scales contains 7 items, divided into subscales with similar content. The individual is required to indicate the presence of a symptom over the previous week17. To determine the final score, the DASS-21 scores were multiplied by two and divided into three categories as thresholds for depression (≥ 10), anxiety (≥ 8), and stress (≥ 15).

Dietary intake assessment and fatty acid quality indices calculation

We assessed the food intake of all participants over the past year using a validated standard semi-quantitative 147-item food frequency questionnaire (FFQ)18. A nutritionist completed this tool and subjects reported their frequency of food items on a daily, weekly, monthly, or yearly basis. Nutrient compositions and energy intakes of each food item were estimated using the NUTRITIONIST 4 food analyzer (First Data Bank, San Bruno, CA). The saturated fat cholesterol index (CSI) and omega-6/omega-3 essential fatty acid ratio (N-6/N-3) indices were considered as indices of dietary fat quality. Accordingly, the CSI was calculated by dividing cholesterol by the concentration of saturated fat in foods derived from FFQs data19. A low CSI indicates a low level of cholesterol and/or saturated fat. Additionally, the ratio of N-6 to N-3 was calculated by dividing the N-6 to N-3 content of foods gathered from the FFQ20,21.

Genotyping

By using saturated NACL solution, we first extracted DNA from the whole blood sample22. And with the instructions given, we evaluated the concentration of the extracted DNA with Nanodrop 8000 spectrophotometry and checked its integrity with the help of 1% agarose gel. MC4R genotypes were determined by TaqMan open array using single nucleotide polymorphism (SNP) method23. Using the primers introduced by Zlatohlavek et al.24. The sequence of MC4R (rs17782313) primers used are as follows: primers forward: 5-AAGTTCTACCTACCATGTTCTTGG-3; reverse: 5-TTCCCCCTGAAGCTTTTCTTGTCATTTTGAT-3. Three types of genotypes for this gene including CC, TT and CT were identified. The forward primer of CAV-1 (rs3807992) is 3′AGTATTGACCTGATTTGCCATG 5′ and the reverse primer is 5′ GTCTTCTGGAAAAAGCACATGA 3′. The fragments containing three genotypes including GG, AA, and GA were distinguished.

Statistical analyses

A Kolmogorov–Smirnov test was performed to test the normality of the data. General characteristics of the participants were reported as mean ± standard deviation (SD) according to the fatty acid quality indices tertiles. A one-way analysis of variance (ANOVA) test was used to compare anthropometric indices, and biochemical variables between participants. Analysis of covariance (ANCOVA) was applied to remove confounding results. A generalized linear model (GLM) was used to assess the interactions between genes related to lipid homeostasis and N6/N3 and CSI on stress, anxiety and depression in crude and adjusted models. The results were adjusted for energy intake, age, BMI, PA and thyroid disease. Statistical analyses were done using SPSS version 23.0 (SPSS, Chicago, IL, USA). P-values ​​less than 0.05 were considered statistically significant and P-values ​​less than 0.07 were considered marginally significant.

Ethics approval and consent to participate

Ethics approval and consent to participate Ethics approval for the study protocol was confirmed by The Human Ethics Committee of Tehran University of Medical Sciences (TUMS) with the following identification: IR.TUMS.MEDICINE.REC.1401.504. All methods were carried out in accordance with relevant guidelines and regulations. Each participant was completely informed about the study protocol and provided a written and informed consent form before taking part in the study.

Results

Baseline characteristics of study population according to quartiles of CSI and N6/N3

The general characteristics of study participants, categorized according to quartiles of CSI and N6/N3, were presented in Tables 1 and 2. In the crude model, a significant mean differences among quartiles of the CSI in terms of SLM (P = 0.048), RMR (P = 0.030), and the significant mean difference in terms of WHR (P = 0.043), FFM (P = 0.041), SMM (P = 0.036), BMR (P = 0.042), and marginally significant for SLM (P = 0.057), were observed among quartiles of the N6/N3. After adjustment with confounders, including age, BMI, physical activity, and energy intake, the education (P = 0.026), BF% (P = 0.038), and FMI (P = 0.036) of participants among quartiles of the CSI became significant, and there was a significant mean differences in terms of HOMA index (P = 0.029) among quartiles of the N6/N3.

Table 1 General characteristics of study population according to quartiles of CSI (n = 378) in obese and overweight women.
Full size table
Table 2 General characteristics of study population according to quartiles of N6/N3 (n = 279) in obese and overweight women.
Full size table

Dietary intake of participants according to quartiles of CSI and N6/N3

Dietary intakes of participant’s study population among quartiles of CSI and N6/N3 ratio were presented in Table 3,4. After adjustment with the energy intake, mean differences of grains, dairy, red meat, protein, carbohydrate, total fat, vitamins A, D, K, C, B6, B12, thiamin, riboflavin, niacin, pantothenic acid, biotin, folate, calcium, phosphorus, iron, zinc, copper, manganese, selenium, magnesium (P < 0.001), white meat (P = 0.001), and legumes (P = 0.023) were significant across quartiles of CSI, also a significant mean difference was observed among quartiles of the N6/N3 in terms of red meat, protein, carbohydrate, total fat, vitamins A, D, E, thiamin, riboflavin, niacin, pantothenic acid, B6, biotin, folate, B12, calcium, phosphorus, iron, zinc, copper, manganese, selenium, magnesium (P < 0.001), vegetables (P = 0.009), legumes (P = 0.015), and vitamin K (P = 0.043).

Table 3 Dietary intake of study population according to quartiles of CSI (n = 378) in obese and overweight women.
Full size table
Table 4 Dietary intake of study population according to quartiles of N6/N3 (n = 279) in obese and overweight women.
Full size table

Psychological disorders of study participants according to quartiles of CSI and N6/N3

The psychological disorders of study participants according to quartiles of CSI and N6/N3 were presented in Table 5. As shown in this table, in the crude model, and also after adjusting with confounders (age, energy intake, BMI, thyroid disease, and physical activity) the mean differences of stress, anxiety, depression, DASS-21 across quartiles of CSI and N6/N3 were not significant (P > 0.05).

Table 5 Psychological disorders of study participants according to quartiles of CSI (n = 378) and N6/N3 (n = 279) in obese and overweight women.
Full size table

The interaction between genes related to lipid homeostasis with CSI and N6/N3 on psychological disorders in obese and overweight women

The interaction between genes related to lipid homeostasis with tertiles of the CSI and N6/N3 ratio on psychological disorders were presented in Tables 6 and 7. In the crude model, a positive interaction was observed between TC genotype of MC4R and CSI on depression (β = 0.30, CI = 0.04, 0.56, P = 0.023), and DASS-21 (β = 0.62, CI = − 0.32, 1.27, P = 0.062). After adjusting for age, energy intake, thyroid disease, physical activity, and BMI in model 1, the interaction between TC genotype of MC4R and CSI on depression (β = 0.39, CI = 0.12, 0.66, P = 0.004), and DASS-21 (β = 0.074, CI = 0.04, 1.44, P = 0.036) remained positive. In particular, TC-alleles carriers were characterized by higher depression and DASS-21 when had the highest following CSI, compared to CC homozygote. In addition, there were some marginal significant interactions between AG genotype of CAV-1 and N6/N3 ratio on depression in both crude (β = 13.44, CI = –0.99, 27.88, P = 0.068) and adjustment model1 (β = 16.83, CI = − 0.19, 33.85, P = 0.053) which shows higher adherence to N6/N3 ratio, with higher depression in AG-alleles carriers compared to GG homozygote.

Table 6 The interaction between MC4R with CSI (n = 378) and N6/N3 (n = 279) on psychological disorders in obese and overweight women.
Full size table
Table 7 The interaction between CAV-1 with CSI (n = 378) and N6/N3 (n = 279) on psychological disorders in obese and overweight women.
Full size table

Discussion

To the best of our knowledge, the present study is the first cross-sectional study to investigate the interaction between fatty acid quality indices and genes related to lipid homeostasis on stress, anxiety and depression among overweight and obese women. Accordingly, our results showed that there was an interaction between MC4R, CAV-1 genotypes and dietary fat quality indexes (CSI, W6/W3 ratio) on psychological disorders in overweight and obese women.

Our findings showed that a positive interaction between TC allele carriers of MC4R and higher adherence of CSI on depression and DASS-21. Considering that no studies have been conducted directly in this field, the results were analyzed based on some related studies that examined the components of our study. Yilmaz et al., in a study conducted in European adults, reported that MC4R was associated with increased depressive mood25. Also, in another study, it was shown that there was a significant positive interaction between the MC4R minor allele genotype, who also had higher fat intake, with mental stress in Korean adults26. This gene is associated with increased appetite (especially towards fats) and decreased satiety with the risk of weight gain27. Studies have shown that factors related to obesity, including increased body fat and intake of saturated fatty acids, and finally, inappropriate eating habits are associated with an increase in inflammatory markers, which can lead to an increased risk of depression28,29,30. Some animal evidence via the hypothalamicpituitary‐adrenal (HPA) axis have shown the relationship between MC4R and mental stress and depression and food intake31,32. They also stated that disruption of MC4R neutralizes the effects of antidepressants33.

According to our results, increased adherence to N6/N3 ratio in the interaction with CAV1 genotype (AG-alleles carriers) leads to a positive interaction on depression. Animal pharmacological studies have shown that CAV1 gene expression changes are associated with depression-like behaviors34. CAV1 is considered as one of the main components of Caveolae membrane and a group of integrated membrane proteins and inflammatory stimuli can increase the expression of the CAV1 gene, which itself leads to the intensification of inflammatory signaling events35. It has been reported that a high-fat diet is associated with increased CAV1 secretion from adipose tissue in mice36. In addition, high consumption of SFA can be associated with adverse effects of CAV1 in increasing the risk of metabolic syndrome and obesity37. Obesity is considered an inflammatory condition that can affect the state of the brain in a way that predisposes a person to depression4. Studies have shown that a higher ratio of N6/N3 PUFAs is associated with an increased risk of depressive symptoms38,39. The possible mechanism of this relationship is related to inflammatory responses, such that a high ratio of N6/N3 PUFAs increases the production of arachidonic acid derived from N6, which in turn is associated with an increase in pro-inflammatory factors and may cause Increase depression40,41.

The present study has several limitations. This study is cross-sectional and prevents inference of causality. In addition, the use of a self-report questionnaire that depended on memory and was prone to bias. This study was conducted with a small sample size only on the women population, so it could not be generalized. Despite the mentioned limitations, our study has strong points such as being the first study that investigated the interaction between fatty acid quality indices and genes related to lipid homeostasis on stress, anxiety and depression among overweight and obese women. Also, trained people were used to collect data to minimize bias.

Conclusion

Based on the findings of the study, we found that there was a positive relationship between increased adherence to CSI and depression in TC allele carriers of MC4R, and there was also a positive relationship between higher N6/N3 ratio and depression in AG-allele carriers of CAV1. However, more studies in different populations are needed to confirm the findings.