Pathogenic mutations reveal a role of RECQ4 in mitochondrial RNA:DNA hybrid formation and resolution

Chang, Chou-Wei; Xu, Xiaohua; Li, Min; Xin, Di; Ding, Lin; Wang, Ya-Ting; Liu, Yilun

doi:10.1038/s41598-020-74095-9

Download PDF

Article
Open access
Published: 12 October 2020

Pathogenic mutations reveal a role of RECQ4 in mitochondrial RNA:DNA hybrid formation and resolution

Chou-Wei Chang¹,
Xiaohua Xu¹,
Min Li¹,
Di Xin¹,
Lin Ding²,
Ya-Ting Wang³ &
…
Yilun Liu¹

Scientific Reports volume 10, Article number: 17033 (2020) Cite this article

1916 Accesses
4 Citations
1 Altmetric
Metrics details

Subjects

Abstract

The synthesis of mitochondrial DNA (mtDNA) is a complex process that involves the formation and resolution of unusual nucleic acid structures, such as RNA:DNA hybrids. However, little is known about the enzymes that regulate these processes. RECQ4 is a DNA replication factor important for mtDNA maintenance, and here, we unveil a role of human RECQ4 in regulating the formation and resolution of mitochondrial RNA:DNA hybrids. Mitochondrial membrane protein p32 can block mtDNA synthesis by restricting RECQ4 mitochondrial localization via protein–protein interaction. We found that the interaction with p32 was disrupted not only by the previously reported cancer-associated RECQ4 mutation, del(A420-A463), but also by a clinical mutation of the adjacent residue, P466L. Surprisingly, although P466L mutant was present in the mitochondria at greater levels, unlike del(A420-A463) mutant, it failed to enhance mtDNA synthesis due to the accumulation of RNA:DNA hybrids throughout the mtDNA. Biochemical analysis revealed that P466L mutation enhanced RECQ4 annealing activity to generate RNA:DNA hybrids at the same time reduced its unwinding activity to resolve this structure. Hence, P466L mutation led to a reduced efficiency in completing mtDNA synthesis due to unresolved RNA:DNA hybrids across mtDNA.

TFAM is an autophagy receptor that limits inflammation by binding to cytoplasmic mitochondrial DNA

Article 23 May 2024

High-resolution in situ structures of mammalian respiratory supercomplexes

Article Open access 29 May 2024

Engineered CRISPR-Cas12a for higher-order combinatorial chromatin perturbations

Article Open access 17 May 2024

Introduction

Mitochondria generate the ATP needed by diverse cellular processes to support cell growth. In recent years, mitochondria have gained attention for their potential use as diagnostic tools and as therapeutic targets for cancer treatment¹. Mitochondrial DNA (mtDNA) is small circular DNA that resides in the mitochondria and encodes a subset of the genes required for oxidative phosphorylation (OXPHOS) function to generate ATP². Although each cell may contain multiple copies of mtDNA³, aberrant mtDNA copy numbers in cancer cells have been correlated with tumor aggressiveness and poor survival outcome^{1,4,5,6,7,8,9,10,11}. In addition, reduced mtDNA copy numbers have been linked to multiple diseases, including aging-associated neural/cognitive deterioration and Huntington’s disease^12,13. Clearly, the impact of mtDNA copy number on human health is multi-fold.

mtDNA synthesis initiates from the heavy (H)-strand replication origin, O_H, through the formation of an RNA:DNA hybrid, also known as an R-loop. The RNA:DNA hybrid that serves as a primer for DNA polymerase γ (pol γ) to synthesize H-strand DNA at O_H is generated by a transcriptional event initiated at the light-strand promoter (LSP)¹⁴. To initiate replication, transcription must first be terminated to allow the switch to replication¹⁵. RNA:DNA hybrid not only is required for the replication initiation step at O_H, but this structure also forms extensively as replication intermediates throughout the mtDNA during mtDNA synthesis. This is because even though similar to nuclear DNA replication, mtDNA can be synthesized via strand-coupled, bi-directional mechanism¹⁶, in human cell lines, mtDNA synthesis is primarily asymmetric, as L-strand synthesis does not initiate until H-strand synthesis reaches the L-strand replication origin, O_L, approximately 2/3 of the way around the molecule^14,17. During H-strand synthesis, the displaced single-stranded H-strand template is protected either by the binding of mitochondrial single-stranded binding protein (mtSSB) or by extensive RNA:DNA hybrid formation through a phenomenon known as RNA-incorporation-throughout-the-lagging-strand (RITOLS)^14,18. For L-strand synthesis to take place, the bound mtSSB or RNA:DNA hybrids must be removed from the H-strand template. Although the formation and resolution of these extensive RNA:DNA hybrids across mtDNA during mtDNA synthesis have been observed in cells¹⁴, we have little knowledge of the enzymes involved in these complex processes.

RECQ4, a member of the highly conserved RECQ family of superfamily 2 (SF2) DNA helicases¹⁹, is a critical enzyme for embryonic development²⁰. RECQ4 mutations have been identified in patients suffering from Rothmund-Thomson syndrome (RTS), Baller-Gerold syndrome (BGS), and RAPADILINO syndrome, with phenotypes ranging from developmental defects to premature aging and cancer predisposition²¹. In addition to the SF2 helicase domain, RECQ4 contains a unique N-terminus that resembles the essential yeast replication initiation factor Sld2²². In human cells, RECQ4 is a key component of both the nuclear and mitochondrial replication helicase complexes^23,24. In the nucleus, RECQ4 is important for DNA replication initiation because it promotes the assembly of the active CDC45-MCM2-7-GINS replicative helicase complex^{22,23,25,26,27}. In mitochondria, RECQ4 interacts with the mitochondrial replication helicase TWINKLE and is crucial for maintaining mtDNA copy number in human cells^24,28,29. Previously, we purified RECQ4 protein complexes from various cellular compartments and identified additional RECQ4-interacting proteins, including p32, which directly interacts with RECQ4 and negatively regulates its mitochondrial localization²⁴. This regulation is important for controlling the rate of mtDNA synthesis. One of the most common clinical RECQ4 mutations (1390 + 2delT) results in an internal deletion (ID) between residues A420 and A463³⁰. Cells expressing RECQ4 ID mutant abolished RECQ4-p32 interaction and exhibited increased mitochondrial accumulation of RECQ4 and mtDNA synthesis rate²⁴.

Although the involvement of RECQ4 in mtDNA copy number maintenance has been established, the mechanism by which RECQ4 contributes to mtDNA synthesis remains elusive. In the present study, we show that RECQ4 is important for the formation and resolution of RNA:DNA hybrid both at the replication origin O_H to initiate DNA synthesis and as replication intermediates throughout the mtDNA to facilitate RITOLS. We present evidence that the function of RECQ4 in regulating RNA:DNA hybrids on mtDNA was deregulated by clinical mutation, P466L^30,31,32. P466L mutant exhibited higher affinity for mtDNA in cells, but mtDNA bound by the P466L mutant accumulated unresolved RNA:DNA hybrids compared to mtDNA bound by wild-type (WT) or the RECQ4 ID mutant. In vitro biochemical analyses demonstrated that RECQ4 P466L mutant exhibited enhanced annealing activity to generate RNA:DNA hybrids but reduced unwinding activity to resolve the same structure. Although RNA:DNA hybrids serve to stabilize the H-strand^14,18, the persistent presence of RNA:DNA hybrids can hinder the initiation and progression of second-strand DNA synthesis, leading to reduced mtDNA copy number and altered mitochondrial respiratory efficiency in RECQ4 P466L mutant cells.

Results

RECQ4 is important for the initiation of mtDNA synthesis

RECQ4 localized to multiple cellular compartments, including the mitochondria (Fig. 1a)^24,29,33. Using Seahorse mitochondrial stress tests to measure mitochondrial oxygen consumption rate (OCR), we found that HEK293 cells containing doxycycline (DOX)—inducible shRNA specific to RECQ4 (Fig. 1b) exhibited reduced basal mitochondrial respiratory OCR than cells containing control-shRNA (Fig. 1c, left). Mitochondrial respiratory OCR remained at significantly lower rates in RECQ4-depleted cells than in control cells after treatment with carbonyl cyanmide-p-trifluoromethox-yphenyl-hydrazon (FCCP) to induce maximum electron transport chain function (i.e. stressed condition; Fig. 1c, right), indicating that OXPHOS was reduced after RECQ4 depletion. On the other hand, RECQ4 depletion did not significantly alter the rate of glycolysis, as measured by the extracellular acidification rate (ECAR) under both basal and stressed conditions (Supplementary Fig. 1a).

The reduced mitochondrial OCR correlates with the lower levels of mtDNA in RECQ4-depleted cells as compared to control shRNA-treated cells (Fig. 1d). Consistent with a role of RECQ4 in mtDNA synthesis^24,34, we found that RECQ4-depleted cells exhibited a slower mtDNA recovery compared to cells containing control shRNA after mtDNA was depleted by ethidium bromide (EtBr; Supplementary Fig. 1b,c). We next determined if the defect in mtDNA synthesis in the absence of RECQ4 occurred at the initiation step. For this, we measured the formation of RNA:DNA hybrids at O_H (Fig. 1e) by DNA:RNA immunoprecipitation (DRIP) using an anti-S9.6 antibody, followed by quantitative PCR (qPCR) analysis, and found that RNA:DNA hybrids at O_H were indeed significantly reduced in HEK293 cells after RECQ4 shRNA inductions (Fig. 1f). RNA:DNA hybrids not only serve as RNA primers for initiating DNA synthesis at O_H, but they are also present extensively at other regions of the mtDNA as replication intermediates during asymmetric mtDNA synthesis^14,18. Consistent with a defect in replication initiation at O_H, the amount of RNA:DNA hybrids as replication intermediates at non-O_H loci, such as replication origin O_L, COXIII, ND5 and mitochondrial transfer RNA (mt-tRNA) coding regions (Fig. 1e), also decreased after RECQ4 depletion induced by DOX treatment (Fig. 1f). It has been reported that the RNA molecules needed for generating RNA:DNA hybrids are transcribed in an abundant amount in the mitochondria, and these preformed RNAs can then anneal to the H-strand template in a 3′–5′ direction to protect the H-strand template during mtDNA synthesis³⁵. We found that RECQ4-depleted cells generated more mitochondrial RNA (mtRNA) transcripts produced per mtDNA than control shRNA-treated cells (Fig. 1g), indicating that the reduced RNA:DNA hybrid formation after RECQ4 depletion was not due to decreased mtRNA transcripts.

The lack of RNA priming at O_H in RECQ4-depleted cells suggested a defect in the subsequent step in recruiting mitochondrial replication factors, such TWINKLE replicative helicase, to mtDNA. To test this, we fixed protein-DNA complexes in control and RECQ4 shRNA-treated HEK293 cells and then purified TWINKLE-DNA complexes using an anti-TWINKLE antibody. We subjected the co-purified DNA fragments to qPCR analysis for the presence of mtDNA. Indeed, after normalized to the input mtDNA, we found that TWINKLE associations with all mitochondrial regions, including O_H, were reduced in cells after RECQ4 shRNA induction (Fig. 1h). Altogether, our analysis supports a role of RECQ4 in facilitating the formation of RNA:DNA hybrid to promote the initiation of mtDNA synthesis.

Clinical P466L mutation promotes RECQ4 mitochondrial accumulation

To date, more than 50 mutations in the human RECQ4 gene have been linked to RTS, BGS, and/or RAPADILINO³⁰. One of these clinical mutations, P466L, is in proximity to the 44 amino acids (A420-A463) missing in the ID mutation (Fig. 2a). Because the ID mutant lacks the p32-interacting motif and is able to accumulate in the mitochondria²⁴, we tested if P466L mutation has similar effect on RECQ4 mitochondrial localization. For this, we first attempted to generate stable RECQ4-deficient HEK293 cells by deleting the endogenous RECQ4 alleles using CRISPR technology. Because RECQ4 is an essential protein²⁰, we failed to isolate viable clones with large deletions to completely eliminate both RECQ4 alleles. Nonetheless, CRISPR technology frequently generates frameshift mutations that yield viable cells with residual protein expression, or knockdown (KD)³⁶. Therefore, we were able to isolate a HEK293 clone that contained RECQ4 frameshift mutations (Supplementary Fig. 2a–c), allowing a small but detectable amount of the RECQ4 proteins concentrated in the chromatin-bound (CB) fraction, even though more than 90% of the RECQ4 proteins was depleted in the whole cell extracts (WCE; Fig. 2b). These cells with reduced RECQ4 expression, or RECQ4 KD cells, exhibited slower growth rates, which were restored to a comparable level as the control HEK293 cells after the stable integration of FLAG-tagged RECQ4 construct into the RECQ4 KD cells (Fig. 2c). In addition to introducing the wildtype (WT) RECQ4 protein, we also generated RECQ4 KD cells stably expressing FLAG-RECQ4 ID or P466L mutant at similar levels (Fig. 2d). Like the ID mutant²⁴, we found that P466L mutation also reduced RECQ4-p32 interaction and enhanced RECQ4 interaction with the TWINKLE helicase (Fig. 2d), suggesting that P466L mutant proteins also accumulate in mitochondria. To test this possibility, we fractionated RECQ4 HEK293 KD cells or U2OS KD cells (Supplementary Fig. 2d–h) stably expressing FLAG-RECQ4 ID or P466L mutant proteins to obtain cytosolic (Cyt), mitochondrial (MT) and nuclear (Nuc) fractions, as previously described^24,37. We further confirmed minimum contamination of genomic DNA (gDNA) relative to mtDNA in the purified MT fractions (Fig. 2e). Western blot analysis also showed that the purified MT fractions were free of the proteins known to only localize to the cytosol (e.g. tubulin) or the nucleus (e.g. Lamin A/C) nuclear proteins (Fig. 2f,g). Using this fractionation method, we found that similar to the ID mutant cells (Fig. 2f), there were higher levels of RECQ4 P466L mutant proteins in the mitochondrial fraction compared to RECQ4 protein levels in the respective WT cells (Fig. 2g, Supplementary Fig. 3a). Immunofluorescent microscopy also confirmed that the amount of P466L mutant proteins co-localized with the mitochondria increased (Fig. 2h). These results indicate that like the ID mutant protein, P466L mutant protein accumulates in the mitochondria, a phenomenon consistent with a reduced interaction with p32.

Mitochondrial RNA:DNA hybrids accumulate in RECQ4 P466L mutant cells

We expected that the elevated RECQ4 P466L mutant proteins in the mitochondria also enhance mtDNA synthesis and increase mtDNA to gDNA ratio. Surprisingly, unlike ID mutant-expressing cells, P466L mutant-expressing HEK293 and U2OS cells did not enhance mtDNA levels (Fig. 3a; Supplementary Fig. 3b). After EtBr treatment to deplete mtDNA in both WT and P466L mutant cells (Supplementary Fig. 3c), we found that RECQ4 P466L mutant HEK293 cells showed slower mtDNA recovery as compared to cells expressing WT RECQ4 protein (Supplementary Fig. 3d). The inability of the elevated P466L mutant protein in the mitochondria to increase mtDNA production led us to determine if mtDNA replication initiation is defective in the P466L mutant cells by examining the formation of RNA:DNAs at O_H. Surprisingly, we found that HEK293 cells expressing the P466L mutant exhibited a significant increase in RNA:DNA hybrids at O_H, as compared to the WT or ID mutant cells (Fig. 3b). The increase in RNA:DNA hybrids was also observed at other regions of the mtDNA, such as O_L (Fig. 3c) and the non-origin loci (Fig. 3d–f). Importantly, this increase in P466L mutant cells was specific to mtDNA, as RNA:DNA hybrid levels in gDNA—including exon 3 of ACTB, which we have previously shown to contain RNA:DNA hybrids³⁸—remained comparable between WT and P466L mutant cells (Fig. 3g). To lesser extent, we also observed accumulation of RNA:DNA hybrids on mtDNA in U2OS KD cells expressing the P466L mutant as compared to U2OS KD cells expressing either RECQ4 WT or ID mutant proteins (Supplementary Fig. 4a–d). These results together indicate that the accumulation of RNA:DNA hybrids at O_H is not due to a failure for the replication fork to progress beyond the initiation site, as RNA:DNA hybrids are formed as replication intermediates and further accumulate throughout the mtDNA.

We next asked if the high levels of RNA:DNA hybrids were associated with altered mtRNA transcripts in the RECQ4 P466L mutant cells. Indeed, RECQ4 P466L mutant cells contained elevated levels of mtRNA transcripts produced per mtDNA compared to WT cells (Fig. 4a). However, when we depleted transcription factor TFAM using inducible TFAM-specific shRNA (Fig. 4b) to reduce mtRNA production in P466L mutant cells (Fig. 4c), we found that the amount of RNA:DNA hybrids in all loci tested further increased in RECQ4 P466L mutant cells after the induction of TFAM shRNA (Fig. 4d). The further increase in RNA:DNA hybrid levels after TFAM depletion also led to reduced mtDNA levels in the RECQ4 P466L mutant cells compared to those treated with control shRNA (Fig. 4e). Taken together, these results indicate that increased RNA:DNA hybrid formation in RECQ4 P466L mutant cells is not a consequence of the elevated levels of mtRNA, and that TFAM also has a role in regulating the level of RNA:DNA hybrids on mtDNA that is non-redundant to the role of RECQ4. We infer that the significant accumulation of RNA:DNA hybrids on mtDNA isolated from RECQ4 P466L mutant cells hinder the completion of mtDNA synthesis in these cells, which explains why the elevated level of P466L mutant proteins in the mitochondria fails to enhance mtDNA production in the mutant cells.

RNA:DNA annealing but reduces RNA:DNA unwinding by RECQ4

We next wished to determine the mechanism by which RECQ4 P466L mutation accumulates RNA:DNA hybrids on mtDNA. Since RNA:DNA hybrids were generated throughout the H-strand template during mtDNA synthesis by incorporating processed mtRNA transcripts onto the mtDNA³⁵, an enzyme with RNA:DNA annealing activity is likely involved in this process. Equally, an enzyme with RNA:DNA unwinding activity is expected to resolve these replication intermediates to allow second strand mtDNA synthesis. We previously showed that RECQ4 contains both DNA annealing and unwinding activities³⁹. Therefore, we hypothesized that RECQ4 is involved in either the formation or resolution of RNA:DNA hybrids on mtDNA. To test this hypothesis, we purified recombinant RECQ4 P466L mutant proteins from E. coli (Fig. 5a) and asked if P466L mutant enhances RNA:DNA hybrid formation via its annealing activity, which requires binding to single-stranded DNA (ssDNA) and single-stranded RNA (ssRNA) first. We found that the affinities of RECQ4 P466L mutant proteins to both ssDNA (Fig. 5b) and ssRNA (Fig. 5c) increased by more than twofold compared to the WT proteins. The enhancement correlates with higher efficiency in promoting annealing to generate RNA:DNA hybrids by the P466L mutant compared to RECQ4 WT and the ID mutant (Fig. 5d,e).

We next asked if RECQ4 is capable of unwinding RNA:DNA hybrid and if this activity is affected by the P466L mutation. Comparing to WT and ID mutant proteins, we found that P466L mutant protein showed reduced unwinding activity on both a splayed-arm DNA:DNA substrate (Fig. 6a) and RNA:DNA substrate (Fig. 6b,c). However, the P466L-associated decrease in unwinding activity was not due to a defect in DNA-dependent ATPase activity (Fig. 6d) or reduced binding to RNA:DNA hybrid substrate (Fig. 6e). In the contrary, P466L mutant proteins exhibited higher affinities to RNA:DNA hybrid than both RECQ4 WT and ID mutant proteins. Most likely, the enhanced annealing activity due to P466L mutation promotes reannealing of the dissociated products, leading to a reduction in unwound ssDNA observed in the helicase assays.

P466L mutation enhances RECQ4-mtDNA association

The increased affinity to nucleic acids in vitro led us to ask if RECQ4 P466L mutant enhances its association with mtDNA in cells. For this, we used an anti-FLAG antibody to immunoprecipitate FLAG-tagged WT and P466L RECQ4 from WCEs prepared from HEK293 and U2OS cells treated with crosslinking agents and performed qPCR analysis. Indeed, we found that after normalization with the input mtDNA, there were significantly more P466L mutant proteins associated with all regions of the mtDNA tested in HEK293 cells compared to RECQ4 WT protein (Fig. 7a). This pattern held in U2OS cells, although to a lesser extent (Supplementary Fig. 4e). The increase in the P466L mutant proteins associated with mtDNA was unlikely contributed by the higher level of P466L mutant proteins accumulated in the mitochondria (Fig. 2g; Supplementary Fig. 3a), since the ID mutant, which also accumulated in an abundant amount in the mitochondria (Fig. 2f)²⁴, did not show enhanced mtDNA association (Fig. 7a; Supplementary Fig. 4e). Given that RECQ4 interacts with TWINKLE (Fig. 2d)²⁴, we also examined TWINKLE association with mtDNA and found that the level of TWINKLE proteins bound to mtDNA did not show significant change in P466L mutant cells compared to WT cells (Fig. 7b). In addition to RITOLS, asymmetric mtDNA replication can be achieved by coating the H-strand template extensively with mtSSB, a process known as strand displacement^16,18. Our analysis showed that compared to RECQ4 WT cells, RECQ4 P466L mutant cells did not contain higher levels of mtSSB bound to mtDNA (Fig. 7c). Our results suggest that RECQ4 is involved in asymmetric mtDNA replication primarily via RITOLS but not through mtSSB binding.

Taken together, these studies reveal an increase in RECQ4 ability to promote RNA:DNA annealing and a decreased efficiency in unwinding RNA:DNA hybrids by P466L mutation. These changes in the biochemical properties of RECQ4 are consistent with the accumulation of unresolved mitochondrial RNA:DNA hybrids in P466L mutant cells.

The clinical P466L mutation leads to a reduction in mitochondrial energy production

The deregulated levels of RNA:DNA hybrids in mitochondria by the RECQ4 P466L mutation led us to ask if mitochondrial function is affected in P466L mutant cells. For this, we compared the mitochondrial function of cells expressing WT and P466L mutant RECQ4 by measuring their mitochondrial respiration OCR. We found that both HEK293 (Fig. 8a) and U2OS cells (Fig. 8b) expressing P466L mutant RECQ4 protein had a lower mitochondrial respiration OCR than WT cells, consistent with reduced mitochondrial function. On the other hand, ECAR was not affected in either HEK293 or U2OS cells expressing the P466L mutant (Fig. 8c,d), suggesting that glycolysis is not significantly increased in P466L mutant cells to compensate for reduced mitochondrial function. In conclusion, the P466L mutation of RECQ4 leads to a reduction in mitochondrial function and overall energy production. We suggest that in P466L mutant cells, mitochondrial respiratory function may have been perturbed by the accumulation of RNA:DNA hybrids or RECQ4 mutant proteins to compromise mtDNA metabolism.

Discussion

In this paper, we demonstrated that the switch from a proline to a leucine at residue 466 is sufficient to increase nucleic acid binding affinity of RECQ4. It was reported that a cysteine-rich zinc-knuckle is present adjacent to the clinical P466L mutation sites and that a peptide consisting of this sequence is capable of binding to DNA⁴⁰. Most likely, P466L mutation alters the secondary structure of RECQ4. The crystal structure of the human RECQ4_449-1111 fragment revealed that residues 449–466 are unstructured, followed by a short α-helix at residues 467–475⁴¹. Secondary structural prediction indicates that the P466L mutation allows the α-helix to extend toward the amino terminus, converting part of the unstructured region between residues 460 and 466 into part of the α-helix. It is of great interest to confirm this structural change, which may explain the disruption of the interaction between P466L mutant RECQ4 and p32, as well as the enhanced nucleic acid binding affinity both in vitro and in cells. The higher nucleic acid binding affinity is expected to increase the level of P466L mutant RECQ4 protein bound to both mtDNA and the chromatin in the nucleus. However, like the RECQ4 ID mutant²⁴, expression of RECQ4 P466L mutant protein was observed at a lower level than that of WT RECQ4 in the nucleus (Fig. 2g; Supplementary Fig. 3a), which is expected to offset the potential increase in its chromatin association.

In mammalian cells, mtDNA is duplicated via either a strand-coupled or asymmetric DNA replication mechanism, and RNA:DNA hybrid is a key replication intermediate during asymmetric DNA synthesis via RITOLS¹⁶. It has been reported that the RNA molecules needed for generating RNA:DNA hybrids are transcribed in an abundant amount in the mitochondria, and these preformed RNAs can then anneal to the H-strand template in a 3′–5′ direction to protect the H-strand template during mtDNA synthesis³⁵. Both the formation of RNA:DNA hybrids and the timely resolution of these replication intermediates are important for efficient mtDNA synthesis. Our data provide evidence that RECQ4 promotes both the formation and resolution of RNA:DNA hybrids on mtDNA. We propose that the annealing activity of RECQ4 can contribute to RNA:DNA hybrid formation on mtDNA, while its unwinding activity can resolve RNA:DNA hybrids to allow second strand synthesis (Fig. 8e). RECQ4 can also stabilize RNA:DNA hybrids via direct binding. Increase in the annealing efficiency and reduced unwinding activity of RECQ4 by P466L mutation is consistent with the accumulation of RNA:DNA hybrids on mtDNA in the P466L mutant cells.

Our study also provides evidence that RECQ4 plays a crucial role in the initiation of mtDNA synthesis by facilitating the formation of RNA:DNA hybrid to serve as RNA primer to initiate DNA synthesis at the replication origin O_H. Consistent with a defect in initiating mtDNA synthesis, TWINKLE associations with all mitochondrial regions tested were reduced in RECQ4-depleted cells compared to control shRNA-treated cells. On the other hand, in cells expressing RECQ4 ID mutant, which accumulates in the mitochondria and enhances mtDNA synthesis²⁴, TWINKLE replicative helicase was enriched specifically at the O_H replication origin (Fig. 7b), providing further evidence that RECQ4 plays a role in facilitating replication initiation at O_H to promote mtDNA synthesis.

Our observation reveals an inverse correlation between mtDNA synthesis and mtRNA transcription, consistent with previous reports that there is a switch between mitochondrial replication initiation and transcription, as mtDNA replication at O_H is initiated by terminating mitochondrial transcription from LSP¹⁵. Indeed, RECQ4-depleted cells exhibited reduced mtDNA synthesis, and these cells contained a greater number of mitochondrial transcripts produced per mtDNA (Fig. 8e). On the other hand, the increased mtDNA replication synthesis may explain for why we also observed that RNA transcripts generated per mtDNA were reduced in the RECQ4 ID mutant cells compared to the WT RECQ4 cells (Fig. 4a)²⁴. Even though RECQ4 P466L mutant cells exhibited normal replication initiation as indicated by the similar amount of TWINKLE associated with the O_H region as in RECQ4 WT cells, there was an increase in RNA transcripts being produced per mtDNA in these cells. Since RT-PCR using random primers is expected to amplify RNA transcripts generated from both LSP and the heavy-strand promoter (HSP), we suggest that the inability to initiate or complete the second DNA synthesis due to the persistent presence of the RNA:DNA hybrids may allow processive transcription to take place from HSP, which is also terminated early during normal mtDNA replication¹⁵.

Finally, although both the ID and P466L are disease-associated mutations identified in human population, patients with these mutations do not share the same disease phenotypes, such as cancer risk³⁰. Elevated mtDNA content is reported to correlate with lymphoma and breast cancer risk⁴². The increase in mtDNA production specifically by the RECQ4 ID mutation but not the P466L mutation may explain for why only the ID mutation strongly associates with cancer incidence, especially lymphoma³⁰.

Materials and methods

Plasmids

Plasmids expressing WT RECQ4 were generated by cloning RECQ4 into a pCMV-FLAG vector, as previously described²³. For in vitro assays, a recombinant N-terminal His-tagged and C-terminal FLAG-tagged RECQ4 (His-RECQ4-FLAG) expression plasmid was generated in a pET16b-FLAG E. coli expression vector, as in our previous studies³⁹. All RECQ4 mutant proteins with deletions or point mutations were generated using single-primer mutagenesis of pCMV-FLAG-RECQ4 or pET16b-RECQ4-FLAG templates. The primer used for generating RECQ4 P466L mutant is listed in Supplementary Table 1. RECQ4 ID mutant constructs and inducible pLKO-tet-on–RECQ4 shRNA plasmid were generated previously²⁴. To generate inducible pLKO-tet-on–TFAM shRNA plasmid, a DNA fragment containing the synthesized oligonucleotides (Supplementary Table 1) was annealed and cloned into pLKO-tet-on vector between AgeI and EcoRI sites. To induce transient KD, cells with the shRNA stably integrated into the genome were treated with 100 ng/ml DOX treatment for 48 h prior to analysis.

Cell culture, transfection, and cell proliferation assay

HEK293 and U2OS cells were cultured in DMEM supplemented with 10% v/v FBS or Serum Plus II (Sigma-Aldrich) and streptomycin/penicillin (100 U/ml). DNA transfection was carried out using Continuum Transfection Reagent (Gemini Bio-Products) according to the manufacturer's instructions. Inducible RECQ4 KD cells were generated by stably integrating the pLKO-tet-on–RECQ4 shRNA plasmid into HEK293 cells. Single clones #1 and #2 were selected for their optimal KD efficiency after DOX treatment. Stable HEK293 and U2OS RECQ4 KD cells were generated using CRISPR technology. Two CRISPR guide RNA (gRNA) sequences, gRNA-1 (CACCGCGTGGGAGCGCGCGTTCCGA) against Exon 1 and gRNA-2 (CACCGCGCACTCTGAAGCGTACCAC) against Exon 2 were designed using online CRISPR design tools: https://tools.genome-engineering.org⁴³ and cloned into pSpCas9(BB)-2A-Puro (PX459) plasmid (a gift from Dr. Feng Zhang; Addgene plasmid #48139 https://n2t.net/addgene:48139; RRID:Addgene_48139). PX459-gRNA-1 and pCAGGS-NZE-GFP (a generous gift from Dr. Jeremy M. Stark, City of Hope) were co-transfected into HEK293 cells using the Continuum Transfection Reagent. 24 h after transfection, single cells expressing GFP were selected using a BD FACSAria III cell sorter and cultured in separate wells of a 96-well plate. RECQ4 KD clones were confirmed via western blot using an anti-RECQ4 antibody. The genomic regions targeted by the gRNA were amplified using PCR with the forward primer (5′-CGG AAT TCC TGG ACG ATC GCA AGC GCG GAG GC-3′) and reverse primer (5′-CGG GAT CCG CAG GGT GCC TTT CAG ATT GGC CT-3′). The PCR products were cloned into a pCMV-FLAG vector and subjected to Sanger sequencing. To generate U2OS RECQ4 KD cells, PX459-gRNA-2 and pCAGGS-NZE-GFP were co-transfected into U2OS cells, and the RECQ4 KD cells were obtained and validated, as described for HEK293 RECQ4 KD cells. To generate cell lines stably expressing WT and mutant RECQ4, WT or mutant pCMV-FLAG-RECQ4 constructs were transfected into RECQ4 KD cells, and stable cell lines were selected using 1 mg/ml G418. Positive clones were confirmed by western blot analysis using an anti-FLAG antibody. For EtBr treatment, cells were exposed to 250 ng/ml EtBr for 7 days in medium additionally supplemented with 100 µg/ml sodium pyruvate and 50 µg/ml uridine. Crystal violet cell proliferation assays were performed as previously described⁴⁴.

Antibodies

Rabbit anti-FLAG (600-401-383, 1:5000) was purchased from Rockland. For immunofluorescent microscopy, mouse anti-FLAG (F1804, 1:100) was purchased from Sigma-Aldrich. Rabbit anti-MCM4 (A300-193A, 1:5000) was purchased from Bethyl Laboratories. Mouse anti-α tubulin (sc-8035, 1:1000), rabbit anti-lamin A/C (sc-20681, 1:3000) and rabbit anti-Histone H3 (sc-10809, 1:500) were purchased from Santa Cruz. Rabbit anti-VDAC1 (ab15895, 1:5000) was purchased from Abcam. Rabbit anti-p32 (6502S, 1:1000) was purchased from Cell Signaling Technology. Rabbit anti-TWINKLE (ARP36483_P050, 1:1000) and rabbit anti-TFAM (OAAN00609, 1:1000) was purchased from Aviva Systems Biology. Mouse anti-mtSSB (1:1000) was kindly provided by Dr. Valeria Tiranti (The Foundation of the Carlo Besta Neurological Institute, IRCCS, Milan, Italy).

Cell fractionation

Cell fractionation was performed as described previously^24,37. Briefly, the cell pellet was resuspended in mitochondrial (MT) buffer (210 mM sucrose, 70 mM mannitol, 1 mM EDTA, 1 mM EGTA, 1.5 mM MgCl₂, 10 mM HEPES pH 7.2) containing protease and phosphatase inhibitors and incubated on ice for 30 min. After homogenization using a Dounce homogenizer (10 strokes) and centrifugation (1000×g, 5 min), the supernatant was collected as the cytoplasmic fraction, and the pellet was collected as intact nuclei. The pellet was further incubated on ice for 15 min in cytoplasmic buffer (10 mM Tris–HCl pH 7.5, 0.34 M sucrose, 3 mM CaCl₂, 2 mM MgCl₂, 0.1 mM EDTA, 1 mM DTT, 0.5% NP40). After centrifugation (2000×g, 2 min), nuclei were washed 2 times with 5 volumes of MT buffer and the pellet was resuspended in MT lysis buffer (20 mM HEPES pH 7.9, 1.5 mM MgCl₂, 1 mM EDTA, 150 mM KCl, 0.1% NP40, 1 mM DTT, 10% glycerol, 0.15 U/ml benzonase, 1 × protease inhibitor, phosphatase inhibitors) and homogenized with a 21G1/2 needle, followed by incubation at 4 °C overnight. After centrifugation (18,000×g, 30 min), the supernatant was collected as the nuclear fraction. The cytoplasmic fraction was further centrifuged (10,000×g, 15 min) to pellet the mitochondria-enriched heavy membrane fraction. The supernatant was collected as the cytosolic fraction without mitochondria. The mitochondria-enriched pellet was washed with MT buffer twice, resuspended, sonicated in MT lysis buffer, incubated on ice overnight before centrifugation (18,000×g, 30 min), and the supernatant was collected as the mitochondrial fraction.

Protein expression and purification

E.coli-expressed recombinant WT and P466L His-RECQ4-FLAG proteins were purified as previously described³⁹. Plasmid-transformed E. coli Rosetta (DE3) pLysS cells were cultured in ampicillin (100 µg/ml) and chloramphenicol (25 µg/ml) containing Luria broth medium until the cell density (OD₆₀₀) was 0.4. Isopropyl-β-d-thio-galactoside was then added to a final concentration of 0.1 mM, and cultures were incubated at 16 °C for 16 h. The bacteria were harvested and lysed in lysis buffer (50 mM potassium phosphate pH 8.0, 10% glycerol, 300 mM KCl, 0.5% Triton X-100, 5 mM β-mercaptoethanol, 1 × protease inhibitor, 1 mM PMSF, 0.2 mg/ml lysozyme), incubated on ice for 30 min, and sonicated at 4 °C. After centrifugation at 16,000×g, the sample was applied to a High-Q column (Bio-Rad), and the flow-through was collected and brought to 0.1% (w/v) in polyethyleneimine (PEI), followed by centrifugation at 16,000 × g to remove the precipitate. The supernatant was applied to a Ni–NTA column and washed sequentially with 1 × buffer B (50 mM potassium phosphate pH 6.0, 10% glycerol, 500 mM KCL, 0.5% Triton X-100, 5 mM β-mercaptoethanol) containing 5 mM imidazole and 1 × buffer B containing 50 mM imidazole, and the His-tagged proteins were eluted with buffer B containing 1 M imidazole. After dialysis against buffer D (50 mM Tris–HCl pH 7.6, 10% glycerol, 500 mM KCl, 0.2% Triton X-100, 1 mM EDTA), the eluate was incubated overnight with anti-FLAG M2 beads (Sigma-Aldrich) at 4 °C. The M2-bound proteins were washed with buffer E (50 mM Tris–HCl pH 7.6, 10% glycerol, 500 mM KCl, 0.2% Triton X-100, 1 mM EDTA, 1 mM DTT), eluted with 3X FLAG peptide elution buffer (50 mM Tris–HCl pH 7.4, 150 mM NaCl, 100 µg/ml 3X FLAG peptide [Sigma-Aldrich]), and dialysed against buffer F (50 mM Tris–HCl, pH8.0, 10% glycerol, 500 mM KCl, 1 mM EDTA, 1 mM DTT). The concentrations of the purified proteins were estimated relative to the Coomassie blue staining signals of BSA standards on SDS–polyacrylamide gels.

DRIP and protein-mtDNA association

ACTB exon 3 DRIP was performed as previously described^38,45. For mtDNA DRIP analysis, cells were harvested and fractionated, and the mitochondrial fraction was lysed in SDS/Proteinase K buffer (50 mM Tris pH 8.0, 10 mM EDTA, 0.5% SDS, 300 μg/ml proteinase K) at 37 °C overnight. After phenol/chloroform extraction and ethanol precipitation, nucleic acids were fragmented using restriction enzymes EcoRV and SacI with or without RNase H at 37 °C overnight. Fragmented nucleic acids were purified using phenol/chloroform extraction and ethanol precipitation, then 2 µg per sample was immunoprecipitated with 2.5 μg of anti-S9.6 antibody and 25 μl protein A agarose in binding buffer (10 mM NaPO₄ pH 7.0, 140 mM NaCl, 0.05% Triton X- 100) at 4 °C for 1 h, followed by extensive washing in binding buffer. The bound nucleic acids were eluted with SDS/Proteinase K buffer at 50 °C for 1 h. For protein-mtDNA association analysis, cells were fixed with 2 mM dithiobis (succinimidyl propionate) for 45 min (FLAG-RECQ4) or with 1% formaldehyde for 10 min (mtSSB and TWINKLE) at room temperature, and the reaction was stopped by the addition of 125 mM glycine. After washing three times with PBS, the cells were lysed in ChIP nuclei lysis buffer (50 mM Tris–HCl pH 8.0, 10 mM EDTA, 1% SDS, 1 × protease inhibitor, phosphatase inhibitors), and chromatin was sheared to approximately 100–500 bp by sonication. The fragmented chromatin was diluted 5 times in ChIP dilution buffer (20 mM Tris–HCl pH 8.0, 157 mM NaCl, 0.01% SDS, 1.1% Triton X-100, 1.1 mM EDTA, 1 × protease inhibitor, phosphatase inhibitors) and incubated overnight with antibodies. Salmon sperm DNA-blocked protein A beads were added to pull down the antibody/protein/DNA complexes with rotation for 1 h at 4 °C. The beads were washed sequentially twice with low salt buffer (20 mM Tris–HCl pH 8.0, 150 mM NaCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA), high salt buffer (20 mM Tris–HCl pH 8.0, 500 mM NaCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA), LiCl buffer (20 mM Tris–HCl pH 8.0, 0.5 M LiCl, 1% NP-40, 1 mM EDTA, 1% deoxycholate), and TE buffer (10 mM Tris–HCl pH 8.0, 1 mM EDTA). The antibody/protein/DNA complexes were eluted with 300 µl elution buffer (0.1 M sodium bicarbonate, 1.0% SDS) at room temperature for 15 min, reverse cross-linked by adding 20 μl of 5 M NaCl, and incubated at 65 °C overnight, followed by treatment with Proteinase K at 45 °C for 2 h and purification by phenol/chloroform extraction and ethanol precipitation. For both DRIP and protein-mtDNA association analyses, the input nucleic acids and the purified nucleic acids were both subjected to qPCR using primers against O_H, O_L, COXIII, ND5 and mt-tRNA (Supplementary Table 2). qPCR was performed using the ABI 7500 Fast Real-Time PCR system and SYBR Green. Enrichment was calculated using the comparative Ct method.

mtDNA level, RT and qPCR

mtDNA measurement was performed as previously described²⁴. For RT, total RNA was isolated using the Quick-RNA MiniPrep kit (Zymo Research). Quality and quantity of RNA was analyzed by NanoDrop ND1000 spectrophotometer. Isolated cellular RNA was used for cDNA synthesis using a High-Capacity RNA-to-cDNA Kit (Applied Biosystems). qPCR was performed in triplicate using SYBR Green Master Mix (Applied Biosystems) on a Light Cycler 7500 Fast (Applied Biosystems).

Helicase, ATPase, DNA annealing, and DNA binding assays

Helicase, ATPase, DNA annealing, and DNA binding assays were performed as previously described³⁹. The radiolabeled splayed-arm DNA:DNA substrate was prepared by labeling X01 oligonucleotides (5′- GAC GCT GCC GAA TTC TAC CAG TGC CTT GCT AGG ACA TCT TTG CCC ACC TGC AGG TTC ACC C-3′) with [γ-³²P] ATP prior to annealing to unlabeled X04 oligonucleotides (5′- ATC GAT AGT CGG ATC CTC TAG ACA GCT CCA TGT AGC AAG GCA CTG GTA GAA TTC GGC AGC GT-3′). The annealed products were gel-purified prior to analysis. For splayed-arm RNA:DNA substrates, ³²P-labeled X01 oligonucleotides were annealed to unlabeled X04 RNA oligonucleotides (5′- AUC GAU AGU CGG AUC CUC UAG ACA GCU CCA UGU AGC AAG GCA CUG GUA GAA UUC GGC AGC GU-3′). Helicase assays were performed by incubating the purified WT or mutant RECQ4 proteins with ³²P-labeled substrates in helicase buffer (30 mM Tris–HCl pH 7.5, 5 mM MgCl₂, 5 mM ATP, 1 mM DTT, 100 μg/ml BSA, 10% glycerol) at 37 °C for 30 min. The reactions were stopped by adding stop buffer (30 mM Tris–HCl pH 7.5, 5 mM MgCl₂, 5 mM ATP, 1 mM DTT, 100 µg/ml BSA, 10% glycerol) and 2.5 ng unlabeled X01 at 37 °C for 15 min. The reactions were deproteinized and analyzed on polyacrylamide gels. Annealing reactions were carried out by incubating WT or mutant RECQ4 proteins with 10 pg of ³²P-labeled X01 and 25 pg of unlabeled X04 or X04 RNA in annealing buffer (30 mM Tris pH 7.5, 5 mM MgCl₂, 50 mM KCl, 1 mM DTT, 100 μg/ml BSA, 10% glycerol) at 37 °C for 5 min, followed by incubation with stop buffer at 37 °C for 15 min. DNA binding assays were performed by incubating WT or mutant RECQ4 proteins with 4 pg of ³²P-labeled DNA:DNA or RNA:DNA in DNA binding buffer (30 mM HEPES pH 7.5, 1 mM DTT, 100 µg/ml BSA) on ice for 15 min. The reactions were cross-linked with 1% glutaraldehyde at 37 °C for 15 min, and the protein-DNA complexes were analyzed on 5% native polyacrylamide gels. For ATPase activity assays, purified recombinant WT or P466L RECQ4 proteins were incubated with 1 μg ssDNA and 2.5 × 10² μCi [γ-³²P] ATP in a 10 μl reaction containing ATPase buffer (30 mM Tris pH7.5, 10% glycerol, 5 mM MgCl₂, 50 μM cold ATP, 1 mM DTT, 100 μg/ml BSA) for 1 h at 37 °C. The reactions were stopped by adding 0.5 μl of 0.5 M EDTA, then separated on a PEI-cellulose thin-layer chromatography plate using a solution of 0.8 M LiCl and 1 M formic acid, and incubated in a moist chamber for 1.5 h. The percentage of ATPase hydrolysis was quantified using ImageJ software.

Seahorse mitochondrial stress test

Seahorse XF Cell Mitochondrial Stress Test (Agilent) was carried out as recommended based on the manufacturer’s protocol. To prepare cell samples for analysis, 10⁵ cells per well were seeded for overnight incubation in XF96 tissue culture plates supplemented with 5% CO₂. Cells were then washed twice with 200 µL of XF base medium (pre-warmed) supplemented with 2 mM glutamine, 25 mM glucose and 1 mM sodium pyruvate pH 7.4, followed by 1 h incubation in 150 µl of XF base medium plus 25 µl growth medium (175 µl final) at 37 °C without CO₂ prior to analysis. To perform the Seahorse XF Cell Mitochondrial Stress Test, the following pre-warmed reagents in the amount of 25 µl each were loaded into injector ports of the sensor cartridge calibrated on the XF96 analyzer (Seahorse Bioscience, Billerica, MA, USA): oligomycin to port A (0.8 µM final), FCCP to port B (2.5 µM), and antimycin A to port C (1 µM final). OCR was first measured under basal conditions, and additional measurements were taken after the sequential addition of oligomycin, FCCP, and antimycin A. The measurements were normalized to cell numbers based on MTT cell proliferation assays.

Immunoprecipitation

Cells were harvested and disrupted in 0.5% Triton X-100 lysis buffer (50 mM Tris–HCl pH7.4, 150 mM NaCl, 1 mM EDTA, 0.5% Triton X-100, 10% glycerol, 1 × protease inhibitor). Soluble cell fractions were isolated by centrifugation for 10 min at 16,000 × g, and immunopurification of FLAG-tagged protein complexes from the cell lysates was performed as previously described^38,46. Representative immunoblots from a minimum of three independent experiments are shown.

Immunofluorescence assay

To detect RECQ4 localization, coverslip-cultured FLAG-RECQ4 mutant HEK293 cells were treated with 100 nM MitoTacker (Red CMXRos #9082, Cell Signaling) at 37 °C for 30 min and then fixed with 4% paraformaldehyde at RT for 20 min, followed by permeabilized with 0.1% Triton X-100 at RT for 5 min. The coverslips were incubated with monoclonal anti-FLAG antibody at 37 °C for 1 h. After washing with PBS, the coverslips were incubated with Alexa Fluor Plus 488 (Invitrogen) at 37 °C for 1 h and the cells were covered with mounting medium (SlowFade Gold Antifade Mountant, Invitrogen). The staining patterns were observed under a Zeiss LSM 880 with Airyscan confocal microscope.

Statistics and Reproducibility

A minimum of three independent biological experiments were performed for each figure. For graphs, each data point represents mean of 3 independent biological experiments, each with 3 technical replicates, ± standard deviation. Protein-mtDNA association was quantified as the percentage of a specific sequence in the input mtDNA being pulled down using an antibody against protein of interest minus the percentage from the quantification using protein A beads without antibody. Similarly, DRIP was quantified as the percentage of the input mtDNA being immunopurified using S9.6 antibody minus the quantification from the RNase H treatment. Both the input and immunopurified DNA were quantified by qPCR. The normalization of the immunopurified mtDNA sequence to input mtDNA ensures that each value takes into account the variation in mtDNA levels among different cell lines. p values were calculated using two-tailed student’s t-tests for statistically significant differences. * indicates p value < 0.05, ** indicates p value < 0.01; and *** indicates p value < 0.005. All in vitro analyses using purified recombinant proteins were performed at least three times using 2 different sets of purified proteins.

References

Yu, M. Generation, function and diagnostic value of mitochondrial DNA copy number alterations in human cancers. Life Sci. 89, 65–71. https://doi.org/10.1016/j.lfs.2011.05.010 (2011).
Article CAS PubMed Google Scholar
Ding, L. & Liu, Y. Borrowing nuclear DNA helicases to protect mitochondrial DNA. Int. J. Mol. Sci. 16, 10870–10887. https://doi.org/10.3390/ijms160510870 (2015).
Article CAS PubMed PubMed Central Google Scholar
Satoh, M. & Kuroiwa, T. Organization of multiple nucleoids and DNA molecules in mitochondria of a human cell. Exp. Cell Res. 196, 137–140 (1991).
Article CAS PubMed Google Scholar
Carew, J. S. et al. Increased mitochondrial biogenesis in primary leukemia cells: the role of endogenous nitric oxide and impact on sensitivity to fludarabine. Leukemia 18, 1934–1940. https://doi.org/10.1038/sj.leu.2403545 (2004).
Article CAS PubMed Google Scholar
D’Souza, A. D., Parikh, N., Kaech, S. M. & Shadel, G. S. Convergence of multiple signaling pathways is required to coordinately up-regulate mtDNA and mitochondrial biogenesis during T cell activation. Mitochondrion 7, 374–385. https://doi.org/10.1016/j.mito.2007.08.001 (2007).
Article CAS PubMed PubMed Central Google Scholar
Jeon, J. P. et al. Copy number increase of 1p36.33 and mitochondrial genome amplification in Epstein-Barr virus-transformed lymphoblastoid cell lines. Cancer Genet. Cytogenet. 173, 122–130. https://doi.org/10.1016/j.cancergencyto.2006.10.010 (2007).
Article CAS PubMed Google Scholar
Lan, Q. et al. A prospective study of mitochondrial DNA copy number and risk of non-Hodgkin lymphoma. Blood 112, 4247–4249. https://doi.org/10.1182/blood-2008-05-157974 (2008).
Article CAS PubMed PubMed Central Google Scholar
Shapovalov, Y., Hoffman, D., Zuch, D., de Mesy Bentley, K. L. & Eliseev, R. A. Mitochondrial dysfunction in cancer cells due to aberrant mitochondrial replication. J. Biol. Chem. 286, 22331–22338. https://doi.org/10.1074/jbc.M111.250092 (2011).
Article CAS PubMed PubMed Central Google Scholar
Avnet, S. et al. Increased osteoclast activity is associated with aggressiveness of osteosarcoma. Int. J. Oncol. 33, 1231–1238 (2008).
CAS PubMed Google Scholar
Akiyama, T., Dass, C. R. & Choong, P. F. Novel therapeutic strategy for osteosarcoma targeting osteoclast differentiation, bone-resorbing activity, and apoptosis pathway. Mol. Cancer Ther. 7, 3461–3469. https://doi.org/10.1158/1535-7163.MCT-08-0530 (2008).
Article CAS PubMed Google Scholar
Miyazaki, T. et al. Maintenance of mitochondrial DNA copy number is essential for osteoclast survival. Arthritis Res. Ther. 14, 40 (2012).
Article Google Scholar
Petersen, M. H. et al. Reduction in mitochondrial DNA copy number in peripheral leukocytes after onset of Huntington’s disease. Mitochondrion 17, 14–21. https://doi.org/10.1016/j.mito.2014.05.001 (2014).
Article CAS PubMed Google Scholar
Mengel-From, J. et al. Mitochondrial DNA copy number in peripheral blood cells declines with age and is associated with general health among elderly. Hum. Genet. 133, 1149–1159. https://doi.org/10.1007/s00439-014-1458-9 (2014).
Article CAS PubMed PubMed Central Google Scholar
Holt, I. J. & Reyes, A. Human mitochondrial DNA replication. Cold Spring Harb. Perspect. Biol. https://doi.org/10.1101/cshperspect.a012971 (2012).
Article PubMed PubMed Central Google Scholar
Agaronyan, K., Morozov, Y. I., Anikin, M. & Temiakov, D. Mitochondrial biology Replication-transcription switch in human mitochondria. Science 347, 548–551. https://doi.org/10.1126/science.aaa0986 (2015).
Article ADS CAS PubMed PubMed Central Google Scholar
Bailey, L. J. & Doherty, A. J. Mitochondrial DNA replication: a PrimPol perspective. Biochem. Soc. Trans. 45, 513–529. https://doi.org/10.1042/BST20160162 (2017).
Article CAS PubMed PubMed Central Google Scholar
Herbers, E., Kekalainen, N. J., Hangas, A., Pohjoismaki, J. L. & Goffart, S. Tissue specific differences in mitochondrial DNA maintenance and expression. Mitochondrion 44, 85–92. https://doi.org/10.1016/j.mito.2018.01.004 (2019).
Article CAS PubMed Google Scholar
Yasukawa, T. & Kang, D. An overview of mammalian mitochondrial DNA replication mechanisms. J. Biochem. 164, 183–193. https://doi.org/10.1093/jb/mvy058 (2018).
Article CAS PubMed PubMed Central Google Scholar
Kitao, S. et al. Cloning of two new human helicase genes of the RecQ family: biological significance of multiple species in higher eukaryotes. Genomics 54, 443–452. https://doi.org/10.1006/geno.1998.5595 (1998).
Article CAS PubMed Google Scholar
Ickikawa, K., Noda, T. & Furuichi, Y. Preparation of the gene targeted knockout mice for human premature aging diseases, Werner syndrome, and Rothmund-Thomson syndrome caused by the mutation of DNA helicases. Nippon Yakurigaku Zasshi 119, 219–226 (2002).
Article Google Scholar
Liu, Y. Rothmund-Thomson syndrome helicase, RECQ4: on the crossroad between DNA replication and repair. DNA Repair (Amst) 9, 325–330. https://doi.org/10.1016/j.dnarep.2010.01.006 (2010).
Article CAS Google Scholar
Sangrithi, M. N. et al. Initiation of DNA replication requires the RECQL4 protein mutated in Rothmund-Thomson syndrome. Cell 121, 887–898. https://doi.org/10.1016/j.cell.2005.05.015 (2005).
Article CAS PubMed Google Scholar
Xu, X., Rochette, P. J., Feyissa, E. A., Su, T. V. & Liu, Y. MCM10 mediates RECQ4 association with MCM2-7 helicase complex during DNA replication. EMBO J. 28, 3005–3014. https://doi.org/10.1038/emboj.2009.235 (2009).
Article CAS PubMed PubMed Central Google Scholar
Wang, J. T., Xu, X., Alontaga, A. Y., Chen, Y. & Liu, Y. Impaired p32 regulation caused by the lymphoma-prone RECQ4 mutation drives mitochondrial dysfunction. Cell Rep. 7, 848–858. https://doi.org/10.1016/j.celrep.2014.03.037 (2014).
Article CAS PubMed PubMed Central Google Scholar
Im, J. S. et al. Assembly of the Cdc45-Mcm2-7-GINS complex in human cells requires the Ctf4/And-1, RecQL4, and Mcm10 proteins. Proc. Natl. Acad. Sci. USA 106, 15628–15632. https://doi.org/10.1073/pnas.0908039106 (2009).
Article ADS PubMed PubMed Central Google Scholar
Thangavel, S. et al. Human RECQ1 and RECQ4 helicases play distinct roles in DNA replication initiation. Mol Cell Biol 30, 1382–1396. https://doi.org/10.1128/MCB.01290-09 (2010).
Article CAS PubMed PubMed Central Google Scholar
Im, J. S. et al. RecQL4 is required for the association of Mcm10 and Ctf4 with replication origins in human cells. Cell Cycle 14, 1001–1009. https://doi.org/10.1080/15384101.2015.1007001 (2015).
Article CAS PubMed PubMed Central Google Scholar
Chi, Z. et al. RecQL4 cytoplasmic localization: implications in mitochondrial DNA oxidative damage repair. Int. J. Biochem. Cell. Biol. 44, 1942–1951. https://doi.org/10.1016/j.biocel.2012.07.016 (2012).
Article CAS PubMed PubMed Central Google Scholar
Croteau, D. L. et al. RECQL4 localizes to mitochondria and preserves mitochondrial DNA integrity. Aging Cell 11, 456–466. https://doi.org/10.1111/j.1474-9726.2012.00803.x (2012).
Article CAS PubMed Google Scholar
Siitonen, H. A. et al. The mutation spectrum in RECQL4 diseases. Eur J Hum Genet 17, 151–158. https://doi.org/10.1038/ejhg.2008.154 (2009).
Article CAS PubMed Google Scholar
Larizza, L., Magnani, I. & Roversi, G. Rothmund-Thomson syndrome and RECQL4 defect: splitting and lumping. Cancer Lett. 232, 107–120. https://doi.org/10.1016/j.canlet.2005.07.042 (2006).
Article CAS PubMed Google Scholar
Jin, W. et al. Sensitivity of RECQL4-deficient fibroblasts from Rothmund-Thomson syndrome patients to genotoxic agents. Hum. Genet. 123, 643–653. https://doi.org/10.1007/s00439-008-0518-4 (2008).
Article CAS PubMed PubMed Central Google Scholar
De, S. et al. RECQL4 is essential for the transport of p53 to mitochondria in normal human cells in the absence of exogenous stress. J. Cell. Sci. 125, 2509–2522. https://doi.org/10.1242/jcs.101501 (2012).
Article CAS PubMed Google Scholar
Gupta, S. et al. RECQL4 and p53 potentiate the activity of polymerase gamma and maintain the integrity of the human mitochondrial genome. Carcinogenesis 35, 34–45. https://doi.org/10.1093/carcin/bgt315 (2014).
Article CAS PubMed Google Scholar
Reyes, A. et al. Mitochondrial DNA replication proceeds via a “bootlace” mechanism involving the incorporation of processed transcripts. Nucleic Acids Res. 41, 5837–5850. https://doi.org/10.1093/nar/gkt196 (2013).
Article CAS PubMed PubMed Central Google Scholar
Smits, A. H. et al. Biological plasticity rescues target activity in CRISPR knock outs. Nat. Methods 16, 1087–1093. https://doi.org/10.1038/s41592-019-0614-5 (2019).
Article CAS PubMed Google Scholar
Dimauro, I., Pearson, T., Caporossi, D. & Jackson, M. J. A simple protocol for the subcellular fractionation of skeletal muscle cells and tissue. BMC Res. Notes 5, 513. https://doi.org/10.1186/1756-0500-5-513 (2012).
Article CAS PubMed PubMed Central Google Scholar
Li, M., Pokharel, S., Wang, J. T., Xu, X. & Liu, Y. RECQ5-dependent SUMOylation of DNA topoisomerase I prevents transcription-associated genome instability. Nat. Commun. 6, 6720. https://doi.org/10.1038/ncomms7720 (2015).
Article ADS CAS PubMed Google Scholar
Xu, X. & Liu, Y. Dual DNA unwinding activities of the Rothmund-Thomson syndrome protein, RECQ4. EMBO J. 28, 568–577. https://doi.org/10.1038/emboj.2009.13 (2009).
Article CAS PubMed PubMed Central Google Scholar
Marino, F. et al. Structural and biochemical characterization of an RNA/DNA binding motif in the N-terminal domain of RecQ4 helicases. Sci. Rep. 6, 21501. https://doi.org/10.1038/srep21501 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Kaiser, S., Sauer, F. & Kisker, C. The structural and functional characterization of human RecQ4 reveals insights into its helicase mechanism. Nat. Commun. 8, 15907. https://doi.org/10.1038/ncomms15907 (2017).
Article ADS CAS PubMed PubMed Central Google Scholar
Hu, L., Yao, X. & Shen, Y. Altered mitochondrial DNA copy number contributes to human cancer risk: evidence from an updated meta-analysis. Sci. Rep. 6, 35859. https://doi.org/10.1038/srep35859 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281–2308. https://doi.org/10.1038/nprot.2013.143 (2013).
Article CAS PubMed PubMed Central Google Scholar
Kueng, W., Silber, E. & Eppenberger, U. Quantification of cells cultured on 96-well plates. Anal. Biochem. 182, 16–19 (1989).
Article CAS PubMed Google Scholar
Li, M. et al. SUMO2 conjugation of PCNA facilitates chromatin remodeling to resolve transcription-replication conflicts. Nat. Commun. 9, 2706. https://doi.org/10.1038/s41467-018-05236-y (2018).
Article ADS CAS PubMed PubMed Central Google Scholar
Xu, X., Wang, J. T., Li, M. & Liu, Y. TIMELESS suppresses the accumulation of aberrant CDC45.MCM2-7.GINS replicative helicase complexes on human chromatin. J. Biol. Chem. 291, 22544–22558. https://doi.org/10.1074/jbc.M116.719963 (2016).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We thank Drs. Kerin Higa and Sarah Wilkinson for their comments and expert editing of this manuscript. This work was supported by NIH R01 CA151245 to Y.L. Research reported in this publication included work performed in the Analytical Cytometry Core and Drug Discovery & Structural Biology Core supported by the NCI of NIH under grant number P30CA033572. The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIH.

Author information

Authors and Affiliations

Department of Cancer Genetics and Epigenetics, Beckman Research Institute, City of Hope, Duarte, CA, 91010-3000, USA
Chou-Wei Chang, Xiaohua Xu, Min Li, Di Xin & Yilun Liu
J. Craig Venter Institute, San Diego, CA, 92037, USA
Lin Ding
Memorial Sloan Kettering, New York, NY, 10065, USA
Ya-Ting Wang

Authors

Chou-Wei Chang
View author publications
You can also search for this author in PubMed Google Scholar
Xiaohua Xu
View author publications
You can also search for this author in PubMed Google Scholar
Min Li
View author publications
You can also search for this author in PubMed Google Scholar
Di Xin
View author publications
You can also search for this author in PubMed Google Scholar
Lin Ding
View author publications
You can also search for this author in PubMed Google Scholar
Ya-Ting Wang
View author publications
You can also search for this author in PubMed Google Scholar
Yilun Liu
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

C.C. and Y.L. conceived the study. C.C. performed the majority of the experiments. C.C., X.X. and L.D. generated CRISPR and stable WT and mutant RECQ4-expressing cell lines. D.X. performed the RT-qPCR experiments. M.L. and Y.W. performed the Seahorse analysis. Y.L. wrote the manuscript.

Corresponding author

Correspondence to Yilun Liu.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Chang, CW., Xu, X., Li, M. et al. Pathogenic mutations reveal a role of RECQ4 in mitochondrial RNA:DNA hybrid formation and resolution. Sci Rep 10, 17033 (2020). https://doi.org/10.1038/s41598-020-74095-9

Download citation

Received: 20 March 2020
Accepted: 21 September 2020
Published: 12 October 2020
DOI: https://doi.org/10.1038/s41598-020-74095-9

This article is cited by

DNA replication initiation factor RECQ4 possesses a role in antagonizing DNA replication initiation
- Xiaohua Xu
- Chou-Wei Chang
- Yilun Liu
Nature Communications (2023)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.