Correction to: Cell Research (2013) 23:673–690. doi:10.1038/cr.2013.47; published online 2 April 2013.
The authors apologized for an error in Supplementary information, Table S1. The sequence of the STAT1(2) siRNA used in the study should read as follows:
CCGCAUGGAAGUCAGGUUCUU
Author information
Authors and Affiliations
Additional information
The online version of the original article can be found at 10.1038/cr.2013.47
Rights and permissions
About this article
Cite this article
Fink, K., Martin, L., Mukawera, E. et al. Erratum: IFNβ/TNFα synergism induces a non-canonical STAT2/IRF9-dependent pathway triggering a novel DUOX2 NADPH Oxidase-mediated airway antiviral response. Cell Res 24, 509 (2014). https://doi.org/10.1038/cr.2014.39
Published:
Issue Date:
DOI: https://doi.org/10.1038/cr.2014.39
