Abstract
The CRISPR–Cas systems, as exemplified by CRISPR–Cas9, are RNA-guided adaptive immune systems used by bacteria and archaea to defend against viral infection1,2,3,4,5,6,7. The CRISPR–Cpf1 system, a new class 2 CRISPR–Cas system, mediates robust DNA interference in human cells1,8,9,10. Although functionally conserved, Cpf1 and Cas9 differ in many aspects including their guide RNAs and substrate specificity. Here we report the 2.38 Å crystal structure of the CRISPR RNA (crRNA)-bound Lachnospiraceae bacterium ND2006 Cpf1 (LbCpf1). LbCpf1 has a triangle-shaped architecture with a large positively charged channel at the centre. Recognized by the oligonucleotide-binding domain of LbCpf1, the crRNA adopts a highly distorted conformation stabilized by extensive intramolecular interactions and the (Mg(H2O)6)2+ ion. The oligonucleotide-binding domain also harbours a looped-out helical domain that is important for LbCpf1 substrate binding. Binding of crRNA or crRNA lacking the guide sequence induces marked conformational changes but no oligomerization of LbCpf1. Our study reveals the crRNA recognition mechanism and provides insight into crRNA-guided substrate binding of LbCpf1, establishing a framework for engineering LbCpf1 to improve its efficiency and specificity for genome editing.
This is a preview of subscription content, access via your institution
Access options
Subscribe to this journal
Receive 51 print issues and online access
$199.00 per year
only $3.90 per issue
Buy this article
- Purchase on Springer Link
- Instant access to full article PDF
Prices may be subject to local taxes which are calculated during checkout
Similar content being viewed by others
References
Makarova, K. S. et al. An updated evolutionary classification of CRISPR–Cas systems. Nature Rev. Microbiol. 13, 722–736 (2015)
Wiedenheft, B., Sternberg, S. H. & Doudna, J. A. RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331–338 (2012)
Marraffini, L. A. CRISPR-Cas immunity in prokaryotes. Nature 526, 55–61 (2015)
Barrangou, R. et al. CRISPR provides acquired resistance against viruses in prokaryotes. Science 315, 1709–1712 (2007)
Garneau, J. E. et al. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468, 67–71 (2010)
Westra, E. R. et al. The CRISPRs, they are a-changin’: how prokaryotes generate adaptive immunity. Annu. Rev. Genet. 46, 311–339 (2012)
Sorek, R., Lawrence, C. M. & Wiedenheft, B. CRISPR-mediated adaptive immune systems in bacteria and archaea. Annu. Rev. Biochem. 82, 237–266 (2013)
Schunder, E., Rydzewski, K., Grunow, R. & Heuner, K. First indication for a functional CRISPR/Cas system in Francisella tularensis . Int. J. Med. Microbiol. 303, 51–60 (2013)
Zetsche, B. et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163, 759–771 (2015)
Wright, A. V., Nuñez, J. K. & Doudna, J. A. Biology and applications of CRISPR systems: harnessing nature’s toolbox for genome engineering. Cell 164, 29–44 (2016)
Barrangou, R. & Marraffini, L. A. CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity. Mol. Cell 54, 234–244 (2014)
Horvath, P. & Barrangou, R. CRISPR/Cas, the immune system of bacteria and archaea. Science 327, 167–170 (2010)
van der Oost, J. et al. CRISPR-based adaptive and heritable immunity in prokaryotes. Trends Biochem. Sci. 34, 401–407 (2009)
Jiang, W. & Marraffini, L. A. CRISPR-Cas: new tools for genetic manipulations from bacterial immunity systems. Annu. Rev. Microbiol. 69, 209–228 (2015)
Sternberg, S. H. & Doudna, J. A. Expanding the biologist’s toolkit with CRISPR-Cas9. Mol. Cell 58, 568–574 (2015)
Hsu, P. D., Lander, E. S. & Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262–1278 (2014)
Anders, C., Niewoehner, O., Duerst, A. & Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature 513, 569–573 (2014)
Nishimasu, H. et al. Crystal structure of Staphylococcus aureus Cas9. Cell 162, 1113–1126 (2015)
Nishimasu, H. et al. Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell 156, 935–949 (2014)
Jinek, M. et al. Structures of Cas9 endonucleases reveal RNA-mediated conformational activation. Science 343, 1247997 (2014)
Jiang, F. et al. A Cas9-guide RNA complex preorganized for target DNA recognition. Science 348, 1477–1481 (2015)
Deltcheva, E. et al. CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature 471, 602–607 (2011)
Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–821 (2012)
Hsu, P. D. et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nature Biotechnol. 31, 827–832 (2013)
Garneau, J. E. et al. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468, 67–71 (2010)
Draper, D. E. & Reynaldo, L. P. RNA binding strategies of ribosomal proteins. Nucleic Acids Res. 27, 381–388 (1999)
Draper, D. E., Grilley, D. & Soto, A. M. Ions and RNA folding. Annu. Rev. Biophys. Biomol. Struct. 34, 221–243 (2005)
Fonfara, I. et al. The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA. Nature http://dx.doi.org/10.1038/nature17945 (20 April 2016)
Bessho, Y. et al. Structural basis for functional mimicry of long-variable-arm tRNA by transfer-messenger RNA. Proc. Natl Acad. Sci. USA 104, 8293–8298 (2007)
Kamadurai, H. B., Jain, R. & Foster, M. P. Crystallization and structure determination of the core-binding domain of bacteriophage lambda integrase. Acta Crystallogr. Sect. F 64, 470–473 (2008)
Otwinowski, Z. & Minor, W. Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 276, 307–326 (1997)
McCoy, A. J. et al. Phaser crystallographic software. J. Appl. Crystallgr. 40, 658–674 (2007)
Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallogr. D 60, 2126–2132 (2004)
Adams, P. D. et al. PHENIX: building new software for automated crystallographic structure determination. Acta Crystallogr. D 58, 1948–1954 (2002)
DeLano, W. L. PyMOL Molecular Viewer (http://www.pymol.org) (2002)
Wienken, C. J., Baaske, P., Rothbauer, U. & Braun, D. Protein-binding assays in biological liquids using microscale thermophoresis. Nat. Commun. 1, 100 (2010)
Tang, G. et al. EMAN2: an extensible image processing suite for electron microscopy. J. Struct. Biol. 157, 38–46 (2007)
Scheres, S. H. RELION: implementation of a Bayesian approach to cryo-EM structure determination. J. Struct. Biol. 180, 519–530 (2012)
Acknowledgements
We thank F. Yu and J. He at Shanghai Synchrotron Radiation Facility for help with data collection. We thank J. Chai for critical reading of the manuscript. We acknowledge the Tsinghua University Branch of China National Center for Protein Sciences Beijing for providing the facility support. This research was funded by the National Natural Science Foundation of China grant numbers 31422014, 31450001 and 31300605 to Z.H.
Author information
Authors and Affiliations
Contributions
Z.H. designed the experiments. D.D., K.R. and X.Q. performed the bulk of the experiments. Data were analysed by Z.H., D.D., K.R. and X.Q.; J. Z., M.G., X.G., H. L., N.L., D.Y., C.M., S.W., D.W., B.Z., Y.M., S.F., N.G. and J.W. contributed to some experiments and discussions. Z.H., D.D., K.R. and X.Q. wrote the paper.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing financial interests.
Extended data figures and tables
Extended Data Figure 1 Structural comparison of the RuvC domains of LbCpf1, SaCas9 and SpyCas9.
Structural superposition of LbCpf1RuvC with SaCas9RuvC (PDB, 5CZZ) and SpyCas9RuvC (PDB, 4UN3). The catalytic residues of the three RuvC domains are labelled. LbCpf1RuvC, SaCas9RuvC and SpyCas9RuvC domains are coloured in grey, green and cyan, respectively.
Extended Data Figure 2 Structural comparison of the LbCpf1-bound crRNA and the SpyCas9-bound sgRNA.
Shown are the structures of LbCpf1-bound crRNA (left) and the SpyCas9-bound sgRNA (PDB, 4UN3) (right).
Extended Data Figure 3 The direct repeat sequence of crRNA binds LbCpf1.
a, crRNA in the crystal remains intact. Crystals of the LbCpf1–crRNA complex were collected and the integrity of crRNA was checked by denaturing TBE-urea (10%) polyacrylamide gel electrophoresis and stained by ethidium bromide. b, A crRNA lacking the guide sequence (crRNA*) binds LbCpf1. Data shown here are representative of three independent microscale thermophoresis experiments and the errors were calculated as standard deviation. c, crRNA* inhibits crRNA-guided LbCpf1 endonuclease activity in vitro. 0.8 μg crRNA and 3 μg purified LbCpf1 protein were mixed with varying amount of crRNA*. 1 μg dsDNA was then added to the mixture that was pre-incubated at 37 °C for 10 min. The nucleotides were analysed by running the mixture on TBE-urea polyacrylamide gels (10%) and visualized by ethidium bromide staining. Non-target strand sequence: 5′-TCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGA AAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCTTTAGAGAAGTCATTTAATAAGGCCACTGTTAAAAAGCTTGGCGTAATCAGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAA-3′.
Extended Data Figure 4 Sequence alignment of Cpf1 proteins from different species.
Sequence alignment of Cpf1 proteins from different species. Conserved and similar residues are highlighted with red and yellow grounds respectively. Residues of LbCpf1 involved in crRNA interaction are indicated with slate solid dots at bottom. α-helices and β-strands are shown as curly and arrow symbols, respectively. Protein domains identified in the structure are indicated.
Extended Data Figure 5 crRNA binding triggers dramatic structure rearrangement of LbCpf1.
a, crRNA binding induces no oligomerization of LbCpf1 in sedimentation-velocity analytical ultracentrifugation. The peak sedimentation coefficients and the calculated molecular weights for LbCpf1 in the absence (blue) and presence (red) of crRNA are indicated. The frictional coefficient ratios for LbCpf1 and LbCpf1–crRNA are 2.19 and 1.89, respectively. b, crRNA binding renders LbCpf1 more resistant to trypsin. The full-length LbCpf1 protein was treated with trypsin in the absence or presence of crRNA or crRNA* for 30 min. The samples were then subjected to SDS–PAGE analysis. crRNA*, crRNA with the guide sequence deleted. c, Negative staining electron microscopy analysis of LbCpf1 and LbCpf1–crRNA complexes. Left, representative raw micrographs of negative-stained LbCpf1 (top) and LbCpf1–crRNA complex (bottom) samples. Right, representative 2D class averages of negatively stained particles of LbCpf1 (top) and LbCpf1–crRNA complex (bottom) samples.
Extended Data Figure 6 LHD is stabilized by interaction with LbCpf1 from a different asymmetric unit.
LHD is involved in crystal packing in the LbCpf1–crRNA crystals. Shown in the figure are the LbCpf1–crRNA structures from two neighbouring asymmetric units. The LHD and UK domains of LbCpf1 are shown in magenta and slate, respectively. Packing between the LHD from one asymmetric unit and the UK domain from a neighbouring asymmetric unit is marked with the red dashed circle.
Extended Data Figure 7 A LHD-truncated LbCpf1 protein retains high binding affinity with crRNA.
Data shown are representatives of three independent microscale thermophoresis experiments; error bars, s.d.
Extended Data Figure 8 The interactions of 5′ end of crRNA with LbCpf1.
Detailed interactions of sugar-phosphate backbone of crRNA with LbCpf1 OBD. The residues from OBD responsible for LbCpf1 crRNA cleavage activity are labelled and shown in aquamarine.
Extended Data Figure 9 A model of crRNA-guided LbCpf1 activation.
a, A model of LbCpf1 activation triggered by crRNA. The apo state LbCpf1 is maintained in an expended conformation. LbCpf1 is switched into a substrate-binding state through structural rearrangement trigger by crRNA binding to the OBD of LbCpf1. Then substrate DNA binds to LbCpf1 with the involvement of the LHD and base pairs with the LbCpf1-bound crRNA, resulting in endonuclease cleavage of the dsDNA. b, A model of non-target and target DNA (shown in green) bound to LbCpf1. Individual LbCpf1 domains are coloured according to the scheme in a, crRNA is shown in cartoon and coloured in orange.
Supplementary information
Supplementary Figure
This file contains the uncropped scans, with size marker indications, for Figure 4d and Extended Data Figures 3a, c and 5b. (PDF 283 kb)
Rights and permissions
About this article
Cite this article
Dong, D., Ren, K., Qiu, X. et al. The crystal structure of Cpf1 in complex with CRISPR RNA. Nature 532, 522–526 (2016). https://doi.org/10.1038/nature17944
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1038/nature17944
This article is cited by
-
Molecular basis and engineering of miniature Cas12f with C-rich PAM specificity
Nature Chemical Biology (2024)
-
An alpha-helical lid guides the target DNA toward catalysis in CRISPR-Cas12a
Nature Communications (2024)
-
CRISPR/Cas genome editing in plants: mechanisms, applications, and overcoming bottlenecks
Functional & Integrative Genomics (2024)
-
Targeting miRNA by CRISPR/Cas in cancer: advantages and challenges
Military Medical Research (2023)
-
Anti-CRISPR proteins: a weapon of phage-bacterial arm race for genome editing
The Nucleus (2023)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
